1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sergeu [11.5K]
2 years ago
9

List the layers of the earth in order.

Biology
1 answer:
sattari [20]2 years ago
8 0
1.crust
2. mantle
3. outer core
4.inner core
You might be interested in
Is potassium a mineral and an electrolyte?
RUDIKE [14]

Answer:

Electrolytes are minerals in body fluids. They include sodium, potassium, magnesium, and chloride.

4 0
2 years ago
Read 2 more answers
Science is best describe as
sattari [20]
Carrying out experiments to prove a point and to further knowledge about the world around us and the galaxy we live in
8 0
2 years ago
Please help I’m in a test and will mark brainliest
Elis [28]

Answer:

b d e

Explanation:

5 0
3 years ago
Which is not a basic function of a cell?
melisa1 [442]
Storing energy because it’s not with the other energy
7 0
3 years ago
How does a continent affect the movement of a surface current?
Romashka-Z-Leto [24]
A continents size may move in the way of a current. But most of those are what the average person calls waves on a beach.
4 0
3 years ago
Other questions:
  • How many raccoons are there in the world?
    13·2 answers
  • The seeds of cycads develop within a A. fruit. B. pistil. C. cone. D. flower.
    10·2 answers
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • A true hypothesis Astarte with word ________ and list the IV , continues with ______ and states the DV , and closes with _____ t
    8·1 answer
  • What type of muscle is found in the leg
    6·1 answer
  • The ploidy of cells produced at the end of meiosis is *<br> 4n<br> 2n<br> 1n<br> 3n
    13·1 answer
  • Please help grades are due today
    9·1 answer
  • GIVING 20 POINTS FOR BEST ANSWER. More biology questions I don't understand. I would like all of them answered if possible.
    9·1 answer
  • create a food chain for an ocean ecosystem.identify each organism’s role. Include producer Estuary organisms: algae, sea lion, z
    13·1 answer
  • if u go outer space shouldn't you not see anything because it black and when you look back why is there a glow on and around the
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!