1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
DIA [1.3K]
3 years ago
8

Will give brainliest bio help C and D

Biology
1 answer:
nikitadnepr [17]3 years ago
6 0
Yes it will help you with c and d
You might be interested in
Alcoholism results in the inability of liver cells to properly digest proteins. Which of the following organelles is most likely
dangina [55]
Cells are made up smaller units called organelles that undertake various critical roles in the activities of the cell. Some of these organelles include, mitochondria whose major function is formation and production of energy in the form of ATP, Ribosome is an organelle involved in the protein synthesis, lysosome is involved in the destruction of old and worn out tissues and organelles, Golgi apparatus or complex helps in transportation, modification and packaging of secretions such as proteins and lipids. Therefore, alcoholism affects the activity of lysosomes in the liver since they are tasked in the digestion of proteins using hydrolytic enzymes.
5 0
3 years ago
Distinguishing the Domains of Life
vitfil [10]

Answer:

1) Organisms in this domain can be unicellular or multicellular - Eukarya

2) Organisms in this domain are unicellular and are often found in extreme environments - Archaea

3) Organisms in this domain have cells that contain a nucleus - Eukarya

Explanation:

All living organisms were classified into a large group consisting of three types of organisms called DOMAIN. It is the highest taxonomic rank of organisms. The three domains that life was classified into are: Archaea, Bacteria and Eukarya.

The domain Archaea contains organisms that are unicellular and prokaryotic i.e. they do not have a membrane-bound nucleus. The organisms in this domain are characterized by their ability to survive in harsh environmental conditions e.g hot temperatures etc

The domain Bacteria also consists of unicellular and prokaryotic organisms. They contain cell walls in their cells made up of peptidoglycan unlike domain Archaea and Eukarya.

The domain Eukarya consists of organisms that are both unicellular and multicellular and strictly eukaryotic i.e. possess a membrane bound nucleus that houses their genetic material. They are divided into Kingdoms: Protista, Plantae, Animalia and Fungi.

4 0
3 years ago
Read 2 more answers
A scientist injected some cells with a drug that blocked glycolysis after NADH was formed, but before ATP and pyruvate were form
Stels [109]

Answer:

The cell could not make ATP.

Explanation:

Glycolysis may be defined as the process in which a glucose molecule is broken down into the two molecules of the pyruvate. Pyruvate is used to produce energy through various pathways that depends upon the availability of the oxygen. However when the glycolysis in blocked and the pyruvate is not formed, then the cells would not be able to use either the fermentation or aerobic respiration or the perform citric acid cycle. So the cell does not make any ATP.

5 0
3 years ago
A conveyance __________ signals parts movement.
mote1985 [20]
A conveyance KANBAN signals parts movement because a kanban moves a bunch of parts. 
7 0
3 years ago
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
3 years ago
Other questions:
  • State your hypothesis (developed in step 8) here. be sure to include what you think the ph will be, and why. what is a neutraliz
    8·1 answer
  • Which specific term describes teeth with two ridges, as found in old world-monkey molars?
    14·1 answer
  • About how long (tall) is TMV
    8·1 answer
  • Which isotope has a relatively short half-life?
    7·1 answer
  • How much if the worlds population lives in cities
    7·1 answer
  • Which of these is a characteristic of a parasite? A. It is a helpful organism. B. it lives inside or on a host. C. It makes its
    12·2 answers
  • Represents the presence of the<br> rhesus protein on blood.
    11·1 answer
  • How does Sexual reproduction leads to genetic variation.​
    11·2 answers
  • A group of scientists must complete a study, but they have limited funding from a government organization. What
    14·1 answer
  • After DNA is duplicated, what is it called? What does it look like?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!