<span>involuntary responses are part of the autonomic system
</span>
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
Answer:
1. Lianas - these are woody vines that have roots in the ground but climb up the trees to reach the sunlight. Their leaves and flowers grow in the canopy.
2. Tree trunks - these are tall and thin to allow trees to reach the sunlight.
Hope it helps
Please mark me as the branliest
Thank you
Answer : Option A) He asked what would happen if he deliberately inoculated someone with cowpox fluid from another person.
Explanation : Edward Jenner wanted to know what would happen if he deliberately inoculate the cowpox fluid from some person to another. He tested this experimental results and later on came up with the hypothesis. Which roughly state that someone will not get smallpox because they already had cowpox.
Yay so happyyyyyyyyyyyyy for youuu
