1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
attashe74 [19]
3 years ago
6

What happens if you have an extra chromosome?

Biology
1 answer:
Trava [24]3 years ago
8 0

Answer:

If a person has extra chromosome you or they might have down syndrome

Explanation:

Normally a baby inherits 23 chromosome from each parent which is equal to 46 total and basically those who survive develop down syndrome

You might be interested in
Scientific methodology is a proven method used to study biological systems and conduct experiments leading to valid results.
____ [38]

The term scientific methodology has to do with the process by which knowledge is acquired in science.

<h3>What is scientific methodology?</h3>

The term scientific methodology has to do with the process by which knowledge is acquired in science. This process usually involves the heavy use of experimentation.

First the scientist carries out an observation which leads to the propounding of a hypothesis which is then tested by experiment before it could be accepted as a fact.

Learn more about scientific methodology:brainly.com/question/14368636

#SPJ1

3 0
1 year ago
What is the main enzyme that catalyzes Transcription?
Neporo4naja [7]

Answer:

RNA Polymerase

Explanation:

I took a bio class last year

7 0
3 years ago
PLZ HELP me...im struggling
PIT_PIT [208]
If D is dominant and d is recessive

1. Dd
2. DD
3. dd
4 0
3 years ago
What happens to dna before cell division??
Paul [167]
The nucleus is replicated , therefore a copy of DNA is made
7 0
3 years ago
Give an example of a phenotype for your favorite animal: ___________.
Mazyrski [523]

Answer:

Dogs

Explanation:

Hope this will help

6 0
2 years ago
Other questions:
  • Two similarities between the way<br> that a fungus feeds, and the way that<br> you feed.
    14·1 answer
  • How is birds preserved​
    9·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • What is the sciene if grouping and naming organisms
    8·2 answers
  • The atomic number of carbon is six, which means that a carbon atom has six protons. Carbon has three naturally occurring isotope
    11·1 answer
  • What does the atomic number of an element represent?
    9·2 answers
  • Please answer! Biology stuff...
    15·1 answer
  • 6 In the condition hyperthyroidism, patients have elevated levels of both T3 and 14 due to a malfunction of the
    12·1 answer
  • 17 protons and 18 neutrons what is the mass number and atomic number
    13·1 answer
  • Individuals in a population that have traits or abilities that give them a competitive advantage over other population members a
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!