The complete question is:
a bacterium is infected with an experimentally constructed bacteriophage composed of the T2 phage protein coat and T4 phage DNA. The new phages produced would have
A) T2 protein and T4 DNA
B) T2 protein and T2 DNA
C) a mixture of DNA and proteins of both phages.
D) T4 protein and T4 DNA
E) T4 protein and T2 DNA
A bacterium infected with an experimentally constructed bacteriophage will give new phages with the virus' DNA and the type of proteins that this DNA encodes.
A bacteriophage is a virus that attaches itself to a bacteria and uses it to replicate itself. Viruses have two main parts, a protein coat and their DNA inside it.
- The experimentally constructed bacteriophage has one type of protein that makes the coat, the T2. This type of protein will allow the virus to attach and infect the bacteria.
- Once the virus attaches itself to the bacteria, it will introduce its DNA, T4 type, and use the bacteria elements to replicate it and create new phages.
- As a result, the new phages will have T4 DNA, and the proteins that the virus synthesizes will be the same type as the DNA.
In conclusion, The new phages produced would have D) T4 protein and T4 DNA.
Learn more at:
brainly.com/question/3901247
Answer:
it is called permissive interaction
Explanation:
Explanation:
The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.
1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.
2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.
3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.
In the given question, both promoter sequence are present in the 5'to 3'strand
3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA
The mRNA will be -
5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.
There are two start codon thus two polypeptides will be synthesized.
1. met-thr-asp-ala-val
2. met-thr-asp-val-ala-ser-ser
The soil on the valley floor because it would not have runoff. Hope this helps.
Answer:
A plant cell b/c it has chloroplast
Explanation:
Chloroplast absorbs sunlight also known as light energy used for the process of photosynthesis.
