1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Liono4ka [1.6K]
4 years ago
5

I choose D

Biology
2 answers:
victus00 [196]4 years ago
8 0
<span>C.
protecting itself with needles.
i think</span>
kvasek [131]4 years ago
4 0
I personally think that it's C because all others r present......even D......because plants like climbers do curl around a tree trunk !!!
You might be interested in
Explain the relationship between electrons, neutrons and protons
Lilit [14]
I'm not sure if this what your looking for but, electrons, neutrons, and protons are the three components that make up an atom.

Electrons are negative

Protons are positive

Neutrons are neutral (or in other words have no charge)
4 0
4 years ago
Read 2 more answers
AUUUAACUGUUCUGUCUAGAG
Lana71 [14]

Answer: three sets: ile. leu,phe,cys,leu,glu. glu,ile,cys,leu,val,asp,leu

The most likely sequence to be included is the R to L read, because of the STOP codon if read L to R. The lone ile would be the last amino acid of a different polypeptide, and there is no promoter sequence after the STOP codon.

Explanation:

auu,uaa,cug,uuc,ugu,cua,gag

Ile,STOP,leu,phe,cys,leu,glu

glu,ile,cys,leu,val,asp,leu (reverse)

After a STOP codon, a DNA promoter is required

5 0
3 years ago
Resting a pot on top of a hot
Schach [20]

Answer:

Conduction

....

.........,...............

8 0
3 years ago
The ions in highest concentration in the intracellular fluid are
sammy [17]
Intracellular fluid (ICF) is found only within blood vessels.
8 0
4 years ago
Jams, jellies, preserves, honey, and other foods with high sugar content hardly ever become contaminated by bacteria, even when
vodka [1.7K]
<h2>The correct answer is (A)</h2>

Explanation:

  • The reason why jam, jellies are preserved with high sugar content because it makes the jam and jellies free from bacteria or other microorganisms.
  • Bacteria when goes into the environment which had a high sugar content, gets killed, which happens due to the loss of water from the cell.
  • This is the reason why, not even jams and jellies had a high sugar content but pickle also had a high salt content so as to preserve it from bacteria.
3 0
4 years ago
Other questions:
  • Use the drop-down menus to match each description with the appropriate change of state. Piles of snow turn to puddles of water.
    15·2 answers
  • I think it is A, check my answer?
    8·1 answer
  • What happens to carbon dioxide molecules that result from kerbs cycle?
    5·1 answer
  • if a predator has a prey for its diet and something causes the prey population to decrease, what will happen to the population o
    6·1 answer
  • What does this device do
    15·1 answer
  • Mutations that occur in DNA sequences during replication are___
    14·2 answers
  • What is required in order for the electron transport chain to begin
    10·1 answer
  • The _____ is the primary channel for the transportation of water, mineral and food from the roots and leaves to the rest of the
    12·1 answer
  • As a fishery scientist, you notice that very few cod fish have been caught in the past year. You still see very young and larval
    12·1 answer
  • Why must males inherit colorblindness from their mothers.
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!