1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
elena-14-01-66 [18.8K]
3 years ago
12

What is the sugar coat formed by the carbohydrate side chains?

Biology
1 answer:
bija089 [108]3 years ago
8 0
Glyccocayx sugar coat that surrounds cells
You might be interested in
Identify the bone that articulates with the distal end of the femur. view available hint(s) identify the bone that articulates w
MatroZZZ [7]

The correct answer is: <em>tibia</em>

The femur, also known as the thigh bone, is one of the longest bones of the human body. The distal point of the femur refers to the area furthest away from its point of attachment, which in this case is the hip joint (please refer to the attached image). When referring to the image, you can see that the distal end of the femur articulates with the bone known as the tibia or shin bone. The tibia is the larger of the two bones located at the distal end of the femur. The tibia includes the knee and ankle joints. Therefore, the bone that articulates with the distal end of the femur is the tibia.

7 0
3 years ago
Reasons why the queen is the most important in the hive.<br> (No LINK)
Alex

Answer:

I assume you are referring to bees?

Explanation:

From what I know and this is just surface level knowledge, she is the one who births the hive and usually designates their purpose once she has laid the eggs. She herself does not do much, she is just the one that the infrastructure of the hive follows in maintaining the hive itself. I hope this helps. Good luck!

6 0
3 years ago
Read 2 more answers
What animal eats fiddler crabs?<br><br>​
pogonyaev
Gulls, crows and herons are all opportunists. They'll eat just about anything that they can get their beaks on. That includes fiddler crabs.
5 0
2 years ago
Read 2 more answers
Galaxy that has a dense core of stars and has spiral arms
Slav-nsk [51]
All galaxies have a dense core of stars. Spiral galaxies, however, have arms that are often visible. There are two kinds of spiral galaxies: barred, where there appears to be a line running from arm to arm through the core, and <span>ordinary, where there is no bar. @Badbunnyhunny</span>
3 0
3 years ago
What information do you need to describe an object's location?
Alenkasestr [34]
You need to know the areas region  and  its landform I guess not sure though
8 0
3 years ago
Other questions:
  • The school nurse knows that many children with attention deficit problems are also learning disabled. the nurse should teach the
    14·1 answer
  • How have mendel's laws fared as we have learned more about cell biology and processes such as meiosis?
    13·1 answer
  • Lymph nodes produce what substance that assists in immunity from disease?
    13·1 answer
  • I got a few questions and not a lot of point so please answer .-.
    7·2 answers
  • In a one-trait testcross, the phenotype that disappears in the f1 generation of a homozygous dominant and homozygous recessive c
    5·2 answers
  • Muscles work together as a system to help your body move while adding support.<br> True<br> False
    6·2 answers
  • This is an organelle containing chlorophyll in which most autotrophs transform light energy into chemical energy.
    15·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • According to the article, what is the cause of sick building syndrome and what are the advantages of this cure?
    6·1 answer
  • How come people feel pain?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!