1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
katrin2010 [14]
3 years ago
9

The moon exerts a greater influence then the sun because it is closer . True or false

Biology
1 answer:
taurus [48]3 years ago
7 0
False, because the moon is closer but the sun have the greater effect on earth. Is sun is hot and moon just comes out at night
You might be interested in
The Animalia, Plantae, and Protista are _____.<br> domains<br> kingdoms<br> phyla<br> classes
UkoKoshka [18]
The correct answer is kingdoms
5 0
3 years ago
Read 2 more answers
Get It?
Softa [21]
“Genes and environmental effects are often part of the explanation. “

“...disease-causing alleles of one gene may be suppressed by alleles of another gene elsewhere in the genome, or a person's overall health may influence the strength of a disease phenotype.”

https://www.khanacademy.org/science/high-school-biology/hs-classical-genetics/hs-non-mendelian-inheritance/a/polygenic-inheritance-and-environmental-effects
4 0
3 years ago
Why do sandy beaches form at many sea shores?
dedylja [7]

Waves deposit fine sediments from weathered coastal rocks on the shore.

8 0
3 years ago
What is a function of the integumentary system?
Yuki888 [10]
Its skin so it protects the internal organs and systems

8 0
3 years ago
Read 2 more answers
Can someone tell me the defination of science
Afina-wow [57]
<span>the intellectual and practical activity encompassing the systematic study of the structure and behavior of the physical and natural world through observation and experiment.

</span>
8 0
3 years ago
Other questions:
  • Where is most of a healthy persons fat stored
    10·2 answers
  • How many radians are in 160°
    13·1 answer
  • The different colors revealed as while light passes through a prism represent
    13·1 answer
  • Under the 1980 Low-Level Radioactive Waste Policy Act, each state must take responsibility for its non-defense related, low-leve
    6·1 answer
  • The genome is _______ the genome size.<br><br> A. larger than<br> B. smaller than<br> C. equal to
    7·2 answers
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • Where does reabsorbtion of glucose take place?
    6·1 answer
  • HELP PLEASE I HAVE AN F
    7·1 answer
  • What kind of graph is this?​
    5·2 answers
  • members of the enterobacteriaceae can be distinguished from each other by: group of answer choices the ability to ferment lactos
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!