1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
blondinia [14]
3 years ago
9

Why doctor campbell tell dr crane to wear a surgical mask

Biology
1 answer:
Alexus [3.1K]3 years ago
6 0
<span>She may be carrying diseases, which the natives have no immunities.</span>
You might be interested in
Dramatic changes in sea level occurred throughout the Cenozoic era and the rise and fall of sea level is recorded in the rocks o
ehidna [41]
<span>Virginia Coastal Plain. In addition to the rich fossil finds mentioned, these rocks also include some mastodon fossils which can be found in Quaternary sediments deposited along lakes and rivers.</span>
6 0
3 years ago
Read 2 more answers
What is the smallest taxonomic group that contains organisms of different species?
Vladimir79 [104]
Answer: Genus
From largest to smallest, the pyramid of binomial nomenclature goes: kingdom, phylum, class, order, family, genus, species.
8 0
3 years ago
Crude oil is composed of: a. Fatty acids c. Metal oxides b. Hydrocarbons d. Halogens
xeze [42]

crude oil is composed of B. Hydrocarbons


4 0
3 years ago
Please help and be quick 5 ⭐️
amm1812

Answer:

Orbital

Explanation:

I believe, to the best of my knowledge, that the answer that you're looking for here is the Orbital. Hopefully this helps.

7 0
3 years ago
Read 2 more answers
In 1883, a catastrophic event caused climate change, a massive tidal wave, and violently red sunsets. Which event below would be
bezimeni [28]
It’s A: a volcanic eruption
3 0
3 years ago
Other questions:
  • The cladogram of the kingdom animalia shows the relationship of selected animals based on their shared anatomical features. the
    12·2 answers
  • What happens when blood sugar is low
    14·1 answer
  • Which characteristics makes a cell membrane selectively preamble
    14·2 answers
  • Why are objects that fall near earths surface rarely in free fall?
    9·2 answers
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Q: _____ measures an object's tendency to resist change its motion
    5·2 answers
  • What occurs to the cell during mitosis?
    15·2 answers
  • HURRY HELP ME PLZ
    12·1 answer
  • 4. Chromosomes are tightly coiled strands of DNA structures that exist in
    15·1 answer
  • Which sequence of processes transports water from the atmosphere to the ocean and then back into a cloud?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!