1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Rama09 [41]
3 years ago
15

Asexual reproduction is not only found in the plant kingdom, what is another kingdom has examples of asexual reproduction?

Biology
1 answer:
Sholpan [36]3 years ago
3 0

Answer: Option C

Explanation:

The kingdom Protist and kingdom Fungi has some members that reproduce asexually. Asexual mode of reproduction can be defined as the process by which formation of zygote takes place without the involvement of male and female gametes.

The amoeba and paramecium divides by binary fission and the new individuals formed are identical to their parents.

Some species of fungi also reproduce asexually. Example: zoospores

You might be interested in
Which of the following factors can influence the
Phoenix [80]
Age, Diet, lifestyle choices, environment and RES
4 0
2 years ago
Read 2 more answers
Leaves need to be elevated so they are exposed so they are exposed to sunlight for photosynthesis. Which part of the stem grows
Varvara68 [4.7K]
<span>A stem is one of two main structural axes of a vascular plant, the other being the root. The stem is normally divided into nodes and internodes. The nodes hold buds which grow into one or more leaves, conifer cones, roots, other stems, or flowers (inflorescences); the internodes distance one node from another.</span>
4 0
3 years ago
Read 2 more answers
The work output of a machine divided by the work input is the ____ of the machine
Artist 52 [7]
The work output of a machine divided by the work input is the resistance of the machine
3 0
3 years ago
Is any skin growth, such as a callus, in which there is overgrowth and thickening of the skin.
dexar [7]
Hyperkeratosis is amy lesion with overgrowth and thickening of the skin, such as warts, calluses, and corns.
6 0
2 years ago
Which are the two major conditions associated with obesity?
sineoko [7]
Heart disease and diabetes
8 0
3 years ago
Read 2 more answers
Other questions:
  • The structure of an organism's parts depends on the function of those parts. True or False
    11·1 answer
  • What type of tremor occurs when a body part is placed in a particular position and required to maintain that position for a long
    8·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • What are three questions that focus on the cause and effect relationship between the genetic code and gene expression, mechanism
    12·1 answer
  • Help science!
    9·1 answer
  • A karyotype of a human who has normal sex chromosomes and 43 autosomes will exhibit ___?
    13·1 answer
  • 1. Which of the following is not a characteristic of natural selection?
    14·1 answer
  • During the process of DNA replication, the whole molecule gets copied in the [A] phase of the cell cycle. The DNA strands are se
    13·1 answer
  • PLEASE HELP. WILL GIVE BRAINLIEST. What role do decomposers play in an ecosystem? Be sure to refer to the biogeochemical cycles.
    9·1 answer
  • Although A Long Way Gone by Ishmael Beah is a __________, it uses many elements of __________.
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!