1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
STALIN [3.7K]
3 years ago
12

Why are phrases such as tongue twisters, so hard to pronounce? Please explain specifically.

Biology
1 answer:
zheka24 [161]3 years ago
5 0
Simple, Your BRAIN can only process so much, so the signal to your vocal cords and tongue slow and You mess up Example:
 

SAY PETER Piper picked a pack a pickle peppers 8x

Did you mess up? I bet so

also here an easy one. RUBER BABY BUGGY BUMPER  
You might be interested in
The products that plants produce in photosynthesis are different from the products that animals and some bacteria produce in cel
Anna35 [415]

Answer: Carbohydrates in the form of glucose and oxygen as byproduct.

Explanation:

Photosynthesis is a process which occurs in green plants and in other autotrophs. In this process the autotrophs can prepare their own food by using reactants like water and carbon dioxide to produce glucose which is a carbohydrate which a major source of energy for plants and oxygen gas is released as a byproduct of this chemical reaction. On the contrary to this the cellular respiration can be defined as the process in which the biochemical oxidation of food occurs and energy is released in the form of ATP and carbon dioxide and water are produced.

Thus in photosynthesis the carbon dioxide and water are the reactants whereas in cellular respiration they are the products.

3 0
3 years ago
Specialized cells called. <br> cells help move the skeleton and help the heart beat and pump blood.
Novosadov [1.4K]

Answer:

pacemaker cells.

Explanation:

Cardiac muscle tissue works to keep your heart pumping through involuntary movements. This is one feature that differentiates it from skeletal muscle tissue, which you can control. It does this through specialized cells called pacemaker cells.

6 0
3 years ago
Read 2 more answers
When cells break down food molecules energy is
never [62]
When cells break down food molecules energy is released
3 0
3 years ago
If a strand of DNA has the following base sequence, what would the base sequence of the mRNA that is transcribed be?
Debora [2.8K]

Answer:

AUG GUA CAC UCA UUG GCA GGU UGA

7 0
3 years ago
The diagram shows a fossil of an ancient whale skull and a skull of a present-day whale. The ancient whale is extinct and is bel
bezimeni [28]

Answer: It shows the evolution of mutations. Throughout the lifetime of animals and humans depending on their way of life and how they life it they will slowly mutate into a different animal to be able to life that way..

Explanation: Example- Whales use to have legs and walked around the earth. But also loved to swim and play in water. Over time they began to adapt and mutate into what we know f whales now. With no legs, they have large fins to help them swim in the oceans.

Basically your answer is Evolution of the Animal

7 0
4 years ago
Read 2 more answers
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Which atmospheric layer is least dense? thermosphere stratosphere troposphere mesosphere
    6·1 answer
  • A tree that sheds its leaves at a particular time of year is _____.
    14·2 answers
  • The small structures in the cell that carry out the cell's activities are known as
    10·2 answers
  • What important role does Fire play in a grassland biome ​
    12·1 answer
  • True or false:<br><br>are these answers correct? <br>​
    6·1 answer
  • Water is able to dissolve more substances than any other liquid. This is an example of which property?
    15·1 answer
  • Deciduous vegetation can play a large role in building design as a result of its ability to: a. increase interior lighting level
    13·1 answer
  • Please help thanks!!!!
    12·1 answer
  • Two of the negative effects of sickle cell anemia are ______________________ ______________________________ and ________________
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!