1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
bija089 [108]
3 years ago
13

Determine why digestive enzymes in a cell are enclosed in a membrane-bound organelle.

Biology
1 answer:
vladimir1956 [14]3 years ago
8 0
These digestive enzymes in a cell are encolsed in a membrane-bound organelle to ensure that these digestive enzymes don't digest the other cell organelle or the cell itself. The membrane ensures that what passes from the digestive organelle are to be processed or sometimes destroyed like wastes or such antibodies.

These digestive enzymes are mostly present in the white blood cell of most living organisms because they also help to destroy and to eliminate such parasitic and infiltrating microorganisms such as bacteria, virus and other antibodies.


You might be interested in
As a cell increases in size..
SIZIF [17.4K]

A. The surface area to volume ratio increases

7 0
3 years ago
Erosion by what substance made the sediments rounded?
mars1129 [50]

usually undergoes burial, compaction, and cementation. Clastic sedimentary rocks are the result of weathering and erosion of source rocks, which turns them into pieces—clasts—of rocks and minerals.

8 0
3 years ago
Why are tropical rain forests such rich habitats for many species of animals?
xenn [34]
Tropical rainforests are rich habitats for many species of animals because there are many resources available. There is a lot of water available and a lot of plants. <span> it offers lots of niches for different species. The trees are kind of like skyscrapers, with different species living at different levels and at each level there is a range of species with certain adaptations to allow them to thrive.</span>
5 0
3 years ago
During transcription, initiation involves the attachment of RNA polymerase to the promoter and the start of RNA synthesis.
Alla [95]

Answer:

true

Explanation:

5 0
3 years ago
The delicate balance of life within a biome cannot be disturbed by people.<br><br> true of false
Mice21 [21]

This is very much false because people tend to be very destructive.

7 0
3 years ago
Other questions:
  • In what phase of meiosis are sister chromatids separated and pulled to opposite ends of the cell?
    7·2 answers
  • Temperate deciduous forests are characterized by trees that lose their leaves in the winter. Which of the following is an abioti
    10·2 answers
  • The main difference between prokaryotic and eukaryotic cells is that_____
    7·1 answer
  • Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
    6·1 answer
  • Why is evolution neither entirely fixed nor random
    6·1 answer
  • ASAP
    15·1 answer
  • How does the electron transport chain deal with the electrons removed from sugar molecules?
    6·1 answer
  • An element that is very reactive is most likely a member of the
    13·1 answer
  • An organism is able to maintain a stable internal environment despite changing external conditions. What is this called?
    5·1 answer
  • Which condition is inherited as a dominant allele?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!