1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Elza [17]
3 years ago
5

How can farmers can conserve soil? List three ways.

Biology
1 answer:
Kryger [21]3 years ago
8 0
<span>Use terrace farming. ...Practice contour farming. ...Reduce impervious surfaces. ...Plant a rain garden. ...Use a rain barrel. ...Plant windbreaks. ...<span>Restore wetlands.

</span></span>
You might be interested in
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
3 years ago
Coal formation is largely the result of _____.
Nookie1986 [14]

Answer:magma

Explanation:

4 0
3 years ago
Hey everybody, I have another Biology question.
sladkih [1.3K]

Answer:

initially by meiosis, then by mitosis( last choice)

3 0
3 years ago
Read 2 more answers
In order to provide nutritional information about food, scientists must evaluate how many calories a given food has per serving
Mashutka [201]

Answer:

                 

Explanation:

I am the thing that goes bump in the night. The shadow-like figure all are too afraid to identify in their room. The silent stalker of your waking nightmares and lucid dreams. Do not worry, I can- but will not- hurt you. Your family, however, doesn't have such luck. Do not warn them that I will be following their every move, or it will lead to a grizzly fate for you and your bloodline. I hope that my message has given you closure for the events to come.

In the meantime, you can pray for your family. Maybe I'll have mercy.

5 0
3 years ago
Read 2 more answers
Using the graphs below, which group of moths is better adapted to survive the hunting cycle?
Mrac [35]

Answer:

Using the graphs below, which group of moths is better adapted to survive the hunting cycle?

Light moths on light trees

Explanation:

3 0
3 years ago
Read 2 more answers
Other questions:
  • What kind of matter is formed when atoms of two or more elements bond?
    10·1 answer
  • Some major secretory molecules of the prostate are:
    7·1 answer
  • Which statement is true about cell differentiation?
    5·2 answers
  • PLS ANYONE IT'S URGENT Explain eubacteria ?
    11·2 answers
  • If you remove the biological (etiologic) contamination hazards through destroying microorganisms and their toxins, what mechanis
    15·2 answers
  • What is the function of MITOSIS? (A) To create eggs and sperm(B) To allow a single cell to increase to its maximum size(C) To cr
    6·1 answer
  • In science writing, what is the purpose of historical points of reference?
    5·2 answers
  • What technique did Hershey and Chase use in their experiment that led to the conclusion that DNA, not protein, was the genetic m
    5·1 answer
  • How do plants in the ocean deal with the limited penetration of light into the water?
    14·1 answer
  • In guinea pigs,short fur (S) is dominate to long fur (s). Two heterogeneous guinea pig (Ss) mate
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!