1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
dlinn [17]
4 years ago
6

The decline in bone breakdown and increased mineralization causes blood calcium to ____________ back to normal levels.

Biology
1 answer:
ki77a [65]4 years ago
6 0
The decline in bone breakdown and increased mineralization causes blood calcium to decrease <span>back to normal levels. This happens when there is secretion of calcitonin. This circulation calcitonin is inhibiting </span>osteoclasts<span> and it will stimulate osteoblasts within minutes. The effect of this on osteoclast will cause a decrease in reabsorption and a concurrent increase in deposition because of the osteoblasts activity.</span>
You might be interested in
The proteolytic enzyme trypsin is produced in the pancreas as the zymogen trypsinogen. Trypsinogen is cleaved to yield the activ
Nesterboy [21]

Enteropeptidase (enterokinase) and trypsin are directly activated by trypsinogen.

<h3>What is Trypsin?</h3>
  • By slicing these lengthy chains of amino acids into smaller pieces, the enzyme trypsin in the first part of the small intestine initiates the breakdown of protein molecules. It is a serine protease from the PA clan superfamily that hydrolyzes proteins in the digestive tracts of numerous animals.
  • When the pancreatic enzyme trypsinogen, in the proenzyme form, is activated, trypsin is generated in the small intestine. The carboxyl side of the amino acids lysine or arginine is where trypsin primarily breaks peptide chains.
  • It is employed in a variety of biotechnological procedures. Trypsin proteolysis or trypsinization is the term used to describe the process, and trypsinized proteins are those that have undergone trypsin digestion or treatment.

To know more about trypsin with the given link brainly.com/question/14301571

#SPJ4

3 0
2 years ago
Which of the following is a response caused by an external stimulus?
juin [17]

Answer:

vomiting due to a virus

Explanation:

8 0
3 years ago
Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
erica [24]

Melting temperature of RNA duplex will be higher

Explanation:

  • RNA is a double stranded RNA with two complementary sequences
  • Duplex DNA is simply double stranded DNA
  • It is known A=U base pairs of duplex RNA is less stable than that of A=T base pairs of duplex DNA
  • RNA duplexes are considered to be more stable than DNA duplexes of comparable sequences but physical basis for thermal stability is not much known hence melting temperature of RNA duplex will be higher
5 0
3 years ago
A proposed explanation made on the basis of limited evidence as a starting point for further investigation is _________
faust18 [17]

Answer: :

hi, friend :D

A supposition or proposed explanation made on the basis of limited evidence as a starting point for further investigation.

<em>Your Answer Is Hypothesis!</em>

<em />

<em>xXxAnimexXx</em>

<em />

<em>Have a great day!</em>

7 0
3 years ago
A particular habitat has experienced many changes in environmental conditions over the last 75 years. Which is MOST likely a cha
Lerok [7]

Answer:

adaptations that allow individuals to live in a variety of conditions

 

behaviors that promote the development of adaptations in new environments

Explanation:

IT'S EITHER OF THESE TWO BUT NOT SURE WHICH

6 0
3 years ago
Other questions:
  • why is PCR a necessary step in the analysis of a DNA sample taken from a crime scene A: the sample yields very little DNA B: the
    6·1 answer
  • What is the one part of the nucleotide that differs among the other different nucleotides?
    15·2 answers
  • Suppose a segment of mitochondrial DNA (mtDNA) is compared between two similar modern-day species. It is known that this segment
    13·1 answer
  • Why do meteorites that hit earth provide evidence of the composition of Earths Interior?
    14·1 answer
  • What kind of egg do reptiles lay?
    6·1 answer
  • The ancestors of elephants inhabited every continent expect Antarctic and Australia. But the Asian and African elephants are the
    12·2 answers
  • Which of the following would most likely be the major focus of a biologist?
    12·2 answers
  • Why do you think sustainable development has only recently been proposed as a goal for society?
    11·1 answer
  • Someone please please help me with this !! (Includes the graph )
    12·1 answer
  • Which is a characteristic of fast-­twitch muscle fibers?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!