3 years ago

A carbon atom has six electrons. How are these electrons shared in its atomic orbital shells

1 answer:

7 0

The inner shell of a carbon atom contains two electrons and the outer shell contains four electrons. A carbon atom is a 1S2 2S2 2P2. The capacity of the first shell is 2 and the capacity of the outer shell is 8.

You might be interested in

Why are the leaves in the cactus plant modified to form spines?

Ludmilka [50]

Answer: Leaves in a cactus are modified into spines to reduce loss of water from leaves by transpiration. Then the plant makes from the process of photosynthesis which is performed by the stem.

Explanation:

5 0

3 years ago

Differentiate between parenchyma, collenchyma on the basis of their cell wall. PLS SAY QUICK

MArishka [77]

Answer:

Parenchyma has a thin cell wall of their cells, and are made up of cellulose. Whereas collenchyma cells have an uneven cell wall made up of pectin and hemicellulose. There is a hard and thick cell wall present of the sclerenchyma cells, which is made up of the lignin.

Explanation:

5 0

4 years ago

Type of symmetry in which body parts are arranged in a circle around a central point

lukranit [14]

Type of symmetry in which body parts are arranged in a circle around a central point is called radial symmetry.

This type of symmetry is characteristic for the sessile animals like Cnidaria and Echinodermata. Organisms with radial symmetry have no left or right sides, they have a top and a bottom surface, or a front and a back.

8 0

4 years ago

1-5 For the following DNA sequences, replicate the DNA 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC

Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0

3 years ago

A soccer player sustains a blow to the lateral aspect of the leg when the leg was planted. what anatomical structure in the knee

jonny [76]

Yuyyyyyydnnhbgg ghkoolkvjj

3 0

4 years ago