1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Andru [333]
3 years ago
10

A carbon atom has six electrons. How are these electrons shared in its atomic orbital shells

Biology
1 answer:
storchak [24]3 years ago
7 0
The inner shell of a carbon atom contains two electrons and the outer shell contains four electrons. A carbon atom is a <span>1S2 </span><span>2S2 2P2. The capacity of the first shell is 2 and the capacity of the outer shell is 8. </span>
You might be interested in
Why are the leaves in the cactus plant modified to form spines?​
Ludmilka [50]

Answer:  Leaves in a cactus are modified into spines to reduce loss of water from leaves by transpiration. Then the plant makes from the process of photosynthesis which is performed by the stem.

Explanation:

5 0
3 years ago
Differentiate between parenchyma, collenchyma on the basis of their cell wall.<br> PLS SAY QUICK
MArishka [77]

Answer:

Parenchyma has a thin cell wall of their cells, and are made up of cellulose. Whereas collenchyma cells have an uneven cell wall made up of pectin and hemicellulose. There is a hard and thick cell wall present of the sclerenchyma cells, which is made up of the lignin.

Explanation:

5 0
4 years ago
Type of symmetry in which body parts are arranged in a circle around a central point
lukranit [14]
Type of symmetry in which body parts are arranged in a circle around a central point is called radial symmetry.  
<span>
This type of symmetry is characteristic for the sessile animals like Cnidaria and Echinodermata. Organisms with radial symmetry have no left or right sides, they have a top and a bottom surface, or a front and a back.</span>
8 0
4 years ago
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
A soccer player sustains a blow to the lateral aspect of the leg when the leg was planted. what anatomical structure in the knee
jonny [76]
Yuyyyyyydnnhbgg ghkoolkvjj
3 0
4 years ago
Other questions:
  • HELP?! _______ are the simplest creatures that possess an anus. A. Flatworms B. Roundworms C. Jellyfish D. Sea anemones
    15·1 answer
  • Which is an example of radiation?<br> A -snowman<br> B- CampFire<br> C-Cooking<br> D- Walking
    12·2 answers
  • What is the female part of the flower? What are the parts that make it up?
    15·1 answer
  • Can someone please help me i would really appreciate it !
    10·2 answers
  • Under what conditions would a cell perform lactic acid fermentation instead of the krebs cycle and etc
    11·1 answer
  • The title of a graph should be placed:
    15·2 answers
  • A unicellular organism that does not have a nucleus would belong in which kingdom?
    12·2 answers
  • In your own words, describe how collection fits into the water cycle. Use details to support your answer.
    5·1 answer
  • Cells carry out respiration continuously because all living things need a constant supply of _________________________________.
    11·1 answer
  • Question:
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!