1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
WINSTONCH [101]
3 years ago
13

When the required direction of transport is opposed to concentration levels, a cell (1)_______ expend energy to force (2)_____ a

cross its membrane.
Biology
1 answer:
VLD [36.1K]3 years ago
4 0
2)Active transport
1)I don't know if it's Active or passive but i am pretty sure it's active
You might be interested in
What do the iron-sulfide hypothesis and the lipid membrane hypothesis have in common?
Anettt [7]
The answer to this is the formation of first cells

6 0
3 years ago
The image on the right represents polymerization. Label the parts and the resulting larger molecule.
lutik1710 [3]

Answer:

A: monomer

B: monomer

C: polymer

Explanation: <em> I just did it and it was right </em>

8 0
3 years ago
Read 2 more answers
1. In the first step in the life cycle of a star, it is called a:
lbvjy [14]
I’m pretty sure it’s c. protostar
3 0
3 years ago
Which country has the largest forest areas?
erastova [34]

The correct answer is - Canada.

Canada is the country that has the most forest area from the countries on this list. It is actually the second country in the world by forest area, with only Russia being in front of it. Canada has around 4,916,438 km² of forest. Brazil is very close to it, and it is in the third place globally, with the United States being placed as fourth, China as fifth, and Argentina as eight.

Canada's forests are stretching pretty much all over its southern half, creating a landscape of dense coniferous forests, and in certain areas of deciduous forests. Even Canada's flag has a leaf on it, more specifically a leaf of a maple tree.

6 0
3 years ago
SUPER URGENT I HAVE A 70 POINT TEST TOMORROW!!
melisa1 [442]

Answer:

this is the different states of matter and you can look at the three stages of matter to help you understand the different types of cycles

Explanation:

best of luck! The nitrogen cycle and the carbon cycle can be commonly confused so just go over what the different stages of matter are and then you should have your compare and contrast chart too

4 0
3 years ago
Other questions:
  • Tim has suffered a vasovagal loss of consciousness, commonly known as fainting. environmental triggers, including the smell of t
    7·1 answer
  • The type of tissue that surrounds various organs and supports nerve and blood vessels is called _____.
    5·1 answer
  • Which early humanlike being had the largest brain size, making them advanced hunters and possibly resulting in the disappearance
    11·2 answers
  • Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
    7·1 answer
  • Which organism should have the largest population, and why?
    8·1 answer
  • Evaluate the following statement: Volcanoes are only found along coastlines.<br><br>Please help​
    12·1 answer
  • If the number of frogs decreases which population will most likely increase
    12·2 answers
  • Evidence for evolution includes the presence of a blank which are similar structure shared by different species
    7·1 answer
  • Dis- advantages of renewable energy?
    11·2 answers
  • What adaptations de only bears have that make them able to survive in their ecosystem?
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!