1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alexus [3.1K]
3 years ago
7

Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:

Biology
1 answer:
Kryger [21]3 years ago
4 0

agcgggaugagcgcauguggcgcauaacug
You might be interested in
Which of the following is a scalar quantity?<br> ⇒velocity<br> ⇒speed<br> ⇒force
scoray [572]

Answer: A. Speed

Explanation: Hope it Helps!

4 0
3 years ago
Read 2 more answers
Question 6
Mila [183]

Answer:

Poyo

Explanation:

true

8 0
2 years ago
The body converts all forms of simple sugars into which of the following substances to provide energy to cells?
Vikki [24]
The body converts simple sugars into glucose
5 0
3 years ago
If the conservative model had been correct, how many generations of bacterial cell division would have had to pass before mesels
Reil [10]

No generations or hybrid would form before meselson and stahl would have observed evidence of a band in the cscl gradient.

The conservative model predicts that, following a single replication, half of the newly formed DNA double helices will be made entirely of the original, or old, DNA, and the other half will be entirely new. Then, each double helix would be completely replicated during the second round of replication. After that, 25% of the double helices would be all new, and 25% would be entirely old. Thus, the fraction of entirely new DNA double helices would increase with each succeeding round of replication, but the total number of completely unique DNA double helices would remain constant. Therefore, no hybrid DNA molecule containing 14N and 15N is replicated in the conservative model.

To learn more about conservative model. Click, brainly.com/question/14025877

#SPJ4

3 0
1 year ago
How is genetic expression regulated?
jarptica [38.1K]
It regulates on/off like a light switch
7 0
3 years ago
Other questions:
  • Who is most at risk of spinal cord injury because of preexisting degenerative disorders?
    14·1 answer
  • Which statement best describes the relationship of photosynthesis and energy? The process of photosynthesis is energy-storing be
    5·2 answers
  • Which processes are directly responsible for the presence of the different species of wheat and corn shown in the diagram above?
    8·1 answer
  • A student creates a Gram stain on a bacterial sample that has a mix of gram-negative and gram-positive organisms. The student ac
    7·1 answer
  • This form of RNA carries the code for the production of proteins from the nucleus and to the Ribosome​
    12·1 answer
  • A species is a group of organisms so similar to one another that they can breed and produce fertile offspring. True or False.
    15·1 answer
  • The trait for flower color in the plants shown below is controlled by incomplete dominance. What percent of the offspring will h
    10·1 answer
  • Flock X
    10·1 answer
  • Which two formulas contain 4 atoms of oxygen
    13·2 answers
  • Which event causes tides? O the blowing of the wind O the movement of warm and cool water O the interaction of the moon, the Sun
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!