1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alexus [3.1K]
3 years ago
7

Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:

Biology
1 answer:
Kryger [21]3 years ago
4 0

agcgggaugagcgcauguggcgcauaacug
You might be interested in
Which of these sources of energy have not acquired energy from sun??
steposvetlana [31]
B  wind has nothing to do with the sun

5 0
3 years ago
Read 2 more answers
Which best helps scientists determine the age of fossils
natima [27]
Relative dating best helps determine fossil age. It's where layers of sedimentary rock and fossils pile up on top of each other; the oldest fossils being in the bottom layer and the youngest in the top.
6 0
3 years ago
26. The characteristics of a particular organism are listed below
ki77a [65]

Answer:

the answer is no a thanks

6 0
3 years ago
Why do vaccines work for some diseases but not others?
otez555 [7]

Answer:

The antibodies produced by a vaccine only fight specific antigens.

Explanation:

Antibodies only bind to specific antigen during an immune reaction. The introduction of foreign substance in the body stimulate the B-cells to produce antibodies that fight against infections. Only specific antibodies are produced following antigen presenting cells that bind to antigens. They capture and display the antigens to the antibodies.

3 0
3 years ago
Read 2 more answers
Suppose you discover a new form of a nucleic acid, XNA. Like DNA, it is double-stranded. You are interested in its mode of repli
victus00 [196]

Answer:

A: Unlike DNA, XNA replicates conservatively

Explanation:

<em>The replication of the DNA is </em><em>semi conservative.</em><em> This means that newly replicated double helix DNAs usually consist of one parental strands and one newly synthesized strands. The parental DNA unwinds and each strand serves as template for the synthesis of complementary strands.</em>

In the case of XNA, the two strands of parental XNA were found intact, meaning that the newly produced XNA consist of two newly synthesized strands. This thus means that the replication process is conservative.

Hence, unlike DNA replication that is semi conservative, XNA replication is conservative.

8 0
3 years ago
Other questions:
  • Which evidence supports the big bang theory? the existence of cosmic microwave background radiation light coming from galaxies s
    10·2 answers
  • Can someone please write a 250-word essay about one of these systems
    8·1 answer
  • Recreate the sequence that occurs in the carbon cycle beginning with carbon dioxide gas.
    7·1 answer
  • 26. Which phase of the cell cycle is characterized by a non-dividing cell?​
    10·1 answer
  • What are the advantages of having a double helix contain 2 dna strands
    9·1 answer
  • According to the theory of _____________, mitochondria in cells today are the descendents of aerobic prokaryotes that used oxyge
    15·1 answer
  • Conventional wisdom holds that the development of separate species happens quickly, most often when populations become separated
    6·1 answer
  • How many body systems are in eating a single bite of turkey? PLSS HELP its duo in abt 6 mins!!​
    8·1 answer
  • Which of these unicellular organisms has no definite shape?
    13·2 answers
  • Complete the sentence. City leaders can protect environmental quality by choosing __________ like shoreline vegetation to protec
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!