1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alexus [3.1K]
3 years ago
7

Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:

Biology
1 answer:
Kryger [21]3 years ago
4 0

agcgggaugagcgcauguggcgcauaacug
You might be interested in
Compare renewable and nonrenewable resources, and discuss the effects of each on biodiversity.
Andrei [34K]

Answer:

Renewable resources cannot disappear, non-renewables will not last forever. Non-renewable energy sources, such as coal, nuclear power, oil, and natural gas, are available in limited quantities.

Explanation:

A renewable resource, for example, is solar energy. It is renewable because the sun can never disappear.

Non-renewable resources take a long time to replenish, if this ever happens. Renewable resources naturally recharge over a relatively short period. Non-renewable resources are natural resources that exist in fixed quantities and can be utilized. Examples include fossil fuels such as oil, coal and natural gas.

Both types of resources have a big influence on biodiversity and people shouldn't be spending them without limit.

4 0
2 years ago
Some bed bugs had mutations in their genetic code which allowed them to survive the chemical pesticide and they produced chemica
erica [24]
D. Mutations involved the genetic variation of the bugs are random
4 0
3 years ago
Read 2 more answers
The psychodynamic perspective originated with Sigmund Freud. True or False
Natasha2012 [34]
True because Sigmund Freud (1890-1930) developed these collection of theories
8 0
3 years ago
Read 2 more answers
Explain how the Prunnett square can be used to predict the probability that an offspring from such a cross has a given phenotype
KiRa [710]
A punnet square is used to visually see the dominant and recessive traits. Mendel's law says that alleles pair independently during the formation of gametes (aka sex cells). This means that traits are transmitted to offspring independently of one another.
5 0
3 years ago
An earthquake is best described as a <br><br> Short term<br> Long term<br> Global <br> Climatic
SCORPION-xisa [38]
I would say A) Short-term. Unless the earthquake is extremely powerful it would not be classified in the other three categories, so most earthquakes would be short-term
4 0
2 years ago
Read 2 more answers
Other questions:
  • Increasing intensity and/or duration of prt activities too rapidly (too much – too soon) violates which prt principle?
    15·1 answer
  • Which evidence supports the big bang theory? the existence of cosmic microwave background radiation light coming from galaxies s
    10·2 answers
  • In the space below write a logo advertising the importance of genetic diversity to a population
    9·1 answer
  • Convert the volume of CO2 you measured in the glucose reaction to moles of CO2 using the Ideal Gas Law to solve for n. Assume P
    5·1 answer
  • Who should food handlers ask when they have questions about the minimum cooking temperature for meat?
    7·2 answers
  • Provides support for the cell, has two "suboarts"
    6·1 answer
  • What region of the kidney is between the capsule and the medulla?
    14·1 answer
  • What happens to an organisms energy storage molecules when it reproduces
    6·1 answer
  • What is a non example of a skeletal muscle
    15·1 answer
  • How can you tell me when energy has been transferred? Can you plz Explain support &amp; claim PLz HElP!!!​
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!