1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alexus [3.1K]
3 years ago
7

Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:

Biology
1 answer:
Kryger [21]3 years ago
4 0

agcgggaugagcgcauguggcgcauaacug
You might be interested in
The chemical signal that travels through the bloodstream is part of the blank system
SVETLANKA909090 [29]
Chemical signal can signify the lymphatic, nervous and endocrine system.

Mostly endocrine, the endocrine system is the body system responsible for providing the needed hormones for the body. These hormones and body fluids contribute and catalyse the growth, disposition, sex characteristics and other potential corresponding output of these hormones. 
5 0
3 years ago
Why do experiments usually require a control?
zalisa [80]
Hey There!

Here is your answer:

Your answer is that a experiments should be controlled because the experiment could go out of control which could harm or hurt someone.


Also the definition of a controlled experiment is a part of the experiment that's not touched.

Ex: Water is your controlled experiment that's because our not doing anything to the water.

If you need anymore help just ask me!

Hope this helps!
4 0
4 years ago
a pea plant that has round seeds has the genotype Rr. it is crossed with a pea plant that has wrinkled seeds and the genotype Rr
san4es73 [151]
50% because both are the same Genotyle dominant wise and recessive wise so it will have a fifty fifty chance of having wrinkled seeds
6 0
3 years ago
Read 2 more answers
Answer this question correctly, I've been asking and an answer would be nice, within the hour.
Zanzabum
D. It is type A because A is dominant and i is recessive.
5 0
3 years ago
Why is the menstrual cycle an important adaptation for reproduction in humans?
raketka [301]
The menstrual cycle is practically controlled by a system of hormones that is necessary for reproduction, and when the hormone reaches a heightened level, something called estradiol is made, then the stimulation of the ovaries by a luteinizing hormone.

Once that hormone begins developing, the ovaries make an egg that quickly becomes an ovum. The ovary then releases one egg or two during ovulation. The endometrium (the part that sheds its own cells for the menstruation) peaks after ovulation and changes the lining of the uterus to prepare for the hectic process of pregnancy and child labor. 

Hope that was helpful.
5 0
3 years ago
Other questions:
  • Which statement best describes a climax community? Hurry PLZ ITs A TEST!!!
    5·2 answers
  • 2 Points<br> Where does the energy come from to make ATP in the light reactions?
    13·1 answer
  • Which statement correctly describes what proteins, lipids, and glycogen have in common? a. They are all used as primary energy s
    15·2 answers
  • How are photosynthesis and cellular respiration related?
    9·2 answers
  • Which statement is NOT true concerning reproduction? A. Hereditary information is passed on to the next generation. B. The offsp
    12·1 answer
  • PLEASE HELP! 50 POINTS AND BRAINLIEST!
    10·1 answer
  • Whats TWO Answer Giving Brainliest To first Correct AnSwEr:D......... please HELP
    14·2 answers
  • What kinds of characters can you use to create a data matrix for estimating phylogenetic trees?
    15·1 answer
  • What would most likely result if mitosis was NOT accompanied by cytoplasmic division?
    15·2 answers
  • Characteristics of viruses include all of the following except
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!