1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alexus [3.1K]
3 years ago
7

Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:

Biology
1 answer:
Kryger [21]3 years ago
4 0

agcgggaugagcgcauguggcgcauaacug
You might be interested in
Which term do biologists use to describe the average number of individuals of a species per unit area?
Elan Coil [88]
I believe it is population density.... 
7 0
3 years ago
Read 2 more answers
Describe why the earth experiences high and low tides.
umka2103 [35]
Because of the moons gravitational pull, is strong enough to pull the ocean around... I hope that helps!
5 0
3 years ago
Read 2 more answers
Why is it important for a cell to perform checks after DNA replication?
Lorico [155]
It’s B I think I never had this question but I think it’s B Or C
5 0
3 years ago
The appearance of an organism, such as smooth or wrinkled seeds, is referred to as a:
jasenka [17]
The  physical appearance of an organism is its phenotype which is determined by genotype and the environment. A phenotype is the composite of an organism's observable characteristics or traits, such as its morphology, development, biochemical or physiological properties, behavior, and products of behavior. Genotypes on the other hand are the set of genes in our DNA which is responsible for a particular trait.
3 0
3 years ago
What organ is attached to the umbilical cord in the fetal pig.
Bad White [126]

Answer:

The Liver

Explanation:

The largest organ in the abdominal cavity is by far the liver, just below the diaphragm (the flap of muscle separating the abdominal from the thoracic cavity). Notice the umbilical vein connecting the umbilical cord with the liver

3 0
2 years ago
Other questions:
  • How is wind created?
    9·2 answers
  • In Wisconsin, a very large population of lake trout, in which individuals mate at random, experiences no migration, mutations, n
    8·1 answer
  • Which is a possible result of humans destroying habitats?
    5·1 answer
  • Which layer of skin contains living cells, is vascularized, and lies directly above the hypodermis?
    11·1 answer
  • Which tissue would likely have cells with the greatest number of gap junctions?
    13·2 answers
  • The diagram reveals that lipids and proteins are both parts of cell membranes.They have different functions because lipids work
    12·2 answers
  • Some transport processes use transport proteins in the plasma membrane, but do not require atp. this type of transport is known
    15·1 answer
  • After a copper smelter begins operation, local downwind populations of plants begin to adapt to the resulting air pollution. Sci
    10·1 answer
  • A scientist performed an investigation involving a reaction that produced Al,(50), How many sulfur atoms are represented in this
    14·1 answer
  • a student is investigating cellular transport. what will most likely occur when the student places a cell that is 95% water insi
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!