1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alexus [3.1K]
3 years ago
7

Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:

Biology
1 answer:
Kryger [21]3 years ago
4 0

agcgggaugagcgcauguggcgcauaacug
You might be interested in
Which of the following can be accurately said about climax communities?
andrezito [222]
I believe the answer is b.
3 0
4 years ago
Please help I really would appreciate it
vekshin1

Answer:

Light, electric

Explanation:

4 0
3 years ago
How are the molecules in photosynthesis and cellular respiration similar?
WARRIOR [948]

The two processes are similar in that they both produce energy, albeit in two different forms. They are different in that photosynthesis assembles the glucose molecule, while cellular respiration takes it apart

8 0
3 years ago
If you were looking at a slide from some pond water and you observed a single celled organism that was green in color but also c
timama [110]

Answer:

It was a multi celled organism

Explanation:

7 0
3 years ago
How does human evolution or natural selection relate to the susceptibility of disease?
SOVA2 [1]
They relate because they show that during both natural selection and human evolution u could get a disease during both 
8 0
3 years ago
Other questions:
  • Give two function of the cell​
    10·2 answers
  • How does Dr.Douglas persuade Willie to have his blood drawn?
    6·1 answer
  • What is a supercell???
    11·2 answers
  • What is filled of enzymes that can break down substance in cells to be used later
    12·1 answer
  • DNA is double stranded helix
    5·2 answers
  • The two basic functions of meiosis are to _____.
    9·1 answer
  • The clownfish is a species of fish that lives between the stinging tentacles of sea anemones. The clownfish protects the anemone
    15·2 answers
  • Please Help!! I need it :)
    5·1 answer
  • Large blooms of algae on the surface of a lake keep which abiotic factor from reaching the bottom?
    7·1 answer
  • Write down the hormones secreted by Gonads with one function of each
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!