1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alexus [3.1K]
3 years ago
7

Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:

Biology
1 answer:
Kryger [21]3 years ago
4 0

agcgggaugagcgcauguggcgcauaacug
You might be interested in
How does cardiac muscle tissue look like
Nana76 [90]

Answer:

skeletal muscle tissue, striated or striped.

Explanation:

3 0
3 years ago
Read 2 more answers
The lungs remain inflated because ___________.a. intrapleural pressure is exactly equal to atmospheric pressure b. intrapleural
kkurt [141]

Answer:

Option C,  Intrapleural pressure is less than intrapulmonary pressure

Explanation:

During inspiration, the air enters the lungs due to lower pressure in the intrapulmonary or intra-alveolar  than the atmospheric pressure. During quite respiration, the intrapulmonary pressure reduces to a pressure that is 3 mm Hg lower than that of atmospheric pressure. During quiet expiration, the intrapulmonary pressure rises up to a pressure that is 3 mm Hg higher than that of atmospheric pressure. This leads to lack of air in the intrapleural space thereby producing intrapleural pressure which is lesser than that of intrapulmonary pressure.  

This difference in pressure (i.e higher pressure with in the lungs than the atmosphere)  causes lungs to remain attached to the chest wall and hence looks inflated.  

Hence, option C is correct

8 0
3 years ago
Yellow marrow makes red blood cells true or false
Serggg [28]

Answer:

False

Explanation:

Yellow marrow stores fats

4 0
3 years ago
Which of the following is generally considered an environmental issue? (war, poverty, pollution, crime)
zmey [24]

the answer to your question is POLLUTION

5 0
3 years ago
Which statement describes the offspring of the Fı generation when crossing a pea plant that is true breeding for green seeds wit
alukav5142 [94]

The offspring will inherit one allele from each parent.

<h3><u>Explanation</u>:</h3>

The genetic crossing experiments lead to the formation of different hybrids which has several characters unlike their parents. Here the parents are homozygous.

One of the parent is homozygous yellow with respect to seed colour. So genetic combination of the parent will be YY.

The other parent is homozygous green with respect to seed color. So genetic combination of the parent will be yy.

Now as they are crossed the offsprings will have genetic combination of Yy.

This is seen that the offsprings carry one allele from both the parents.

7 0
3 years ago
Read 2 more answers
Other questions:
  • Is my answer right??
    6·2 answers
  • Bipolar disorder has a _______________ rate of heritability suggesting a biological cause.
    9·1 answer
  • If placed in a hypertonic solution, a plant cell will
    15·1 answer
  • What ALWAYS happens when the nucleotides in a strand of DNA is rearranged?
    11·2 answers
  • Sometimes, when Mendel crossed two pea plants with each other, he obtained a phenotypic ratio of 3:1 purple-flowered pea plants
    12·1 answer
  • most conifers do not lose their needles every fall. How might this extend of conifer's growing season?
    6·1 answer
  • Why are fermentation reactions important for cells?
    14·1 answer
  • Describe why biodiversity increased with the introduction of sea otters in California over the last fifty years
    10·1 answer
  • Transport of materials into a cell against a concentration gradient, from low to high, requires
    11·2 answers
  • Energy and matter are interconvertable
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!