1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alexus [3.1K]
3 years ago
7

Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:

Biology
1 answer:
Kryger [21]3 years ago
4 0

agcgggaugagcgcauguggcgcauaacug
You might be interested in
The heart is composed of 2 pumps. the right side pumps blood to ________ and the left side pumps blood to ______.
liraira [26]
Oxygen
Carbon dioxide
4 0
3 years ago
What evidence must be considered when determining whether or not a trait is an adaptation? (Site 1)
Alexeev081 [22]
According to Charles Darwin's theory of evolution by natural selection, organisms that possess heritable traits that enable them to better adapt to their environment compared with other members of their species will be more likely to survive, reproduce, and pass more of their genes on to the next generation. The next generation will have the things they will need to survive and the longer the generation goes the more fetchers they will have.
4 0
2 years ago
Microbes that thrive in acidic environments seem to have "cost free" ATP energy available to them due to the pre-existing H grad
bixtya [17]

Answer:

The microbes thriving in acidic environments are termed as acidophiles, and these range from eukaryotes to bacteria and archaea, which are mainly found in diverse acidic surroundings like sulfuric geysers and pools, in the human stomach, and in the regions that get polluted by acid mine drainage.  

The mentioned case is not entirely correct as the protons found in the acidic surroundings are not utilized for the generation of ATP as they are not originating from within the cell. In order to sustain their internal acidic pH, the acidophiles exhibit adaptations like the presence of the negatively charged proteins on the surfaces of their membranes so that they can prevent deterioration due to acidic surroundings.  

6 0
3 years ago
A male firefly attempts to impress a female firefly for mating. The female does not recognize the pattern of light used by the m
iris [78.8K]

Behavioral isolation is the answer, just took the assessment.

5 0
3 years ago
Read 2 more answers
A student is studying a cell and can clearly see that is has ribosomes and mitochondria. Which statement best describes how the
zmey [24]
Both plants and animals have these. It is a eukaryotic cell.
6 0
3 years ago
Other questions:
  • Which essential fatty acid is rarely found to be deficient as it is typically consumed in abundance in the majority of diets?
    6·1 answer
  • Est ce que ça arrive que tu as enceinte epuis tu a de période
    14·1 answer
  • Organic compounds ALL contain the element carbon. Which organic compound, used for stored chemical energy, contains
    14·1 answer
  • What is the basic fuel source for all organisms
    6·1 answer
  • While studying the function of a G protein-coupled receptor you develop a modified GTP molecule that has the same binding capabi
    12·1 answer
  • A doctor examines the solid waste of a patient. Which would most likely be evidence that the person is not digesting food correc
    6·2 answers
  • Why was lamrckism rejected by darwinsm
    11·1 answer
  • Kinesiology is composed of a variety of areas of specialized study. These specialized areas, which include sport and exercise ps
    10·1 answer
  • The systolic and diastolic pressure is respectively are:-
    15·2 answers
  • What is a natural depression filled with standing freshwater called giving brainliest
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!