1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alexus [3.1K]
3 years ago
7

Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:

Biology
1 answer:
Kryger [21]3 years ago
4 0

agcgggaugagcgcauguggcgcauaacug
You might be interested in
Study these diagrams. The dots represent valence electrons orbiting the nucleus of an atom. Which diagram shows the valence elec
steposvetlana [31]
In the picture attached to this question, the two diagrams above did not show very well but I believe that the first diagram contain four dots, which means that the correct option is A.
Carbon has six electrons, that is why 6 is its atomic number is 6 . In writing electronic configuration, two electrons are usually placed in the most inner shell while the other shells will have 8 electrons each. In the case of carbon which has 6 electrons, only four will remain after 2 electron has been put in its inner shell. Therefore the number of electron in its outermost shell will be four.
7 0
2 years ago
Read 2 more answers
Give a basic definition of evolution as taught in this unit 2 Lesson 2.16. In 10th grade. Please write in your own words. Will M
oksian1 [2.3K]

Answer:

In biology, evolution is the change in the characteristics of a species over several generations and relies on the process of natural selection. The theory of evolution is based on the idea that all species? are related and gradually change over time.

6 0
2 years ago
Name the acid present in ant sting​
Vlad [161]

Answer:

Ant sting release methanoic acid or formic acid. The chemical formula of methanoic acid is HCOOH

3 0
1 year ago
Read 2 more answers
Station 1: Onion Root Tip
NeX [460]

Answer:

idk

Explanation:

i fr just want points sorry to lazy

3 0
3 years ago
(BRAINLIEST QUESTION) Natural selection is an important part of evolution. It is:
ladessa [460]

Answer:

The answer to the first one is B. A mechanism for the evolution of a population to become better adapted to their environment over many generations.

The answer for the second one is C.vestigial

Explanation:

8 0
3 years ago
Other questions:
  • State when and how often the american medical association recommends that females inspect their breasts
    7·1 answer
  • Penetrance specifically refers to the expression of lethal genes in heterozygotes. True or False
    15·1 answer
  • This mountain slope towers over a town several hundred feet below.Which two weather events present the highest risk to the town?
    13·1 answer
  • Cómo están organizadas las células en los animales
    11·1 answer
  • Principal types of crime in United States include ...
    6·2 answers
  • Which of the following situations or phrases most accurately describes the citric acid cycle?
    11·1 answer
  • The snake that eats the frog in this food chain is called a
    11·2 answers
  • what is a substance, located in the cell membrane and made of amino acids and sugars, that aids in the identification of cell ty
    10·1 answer
  • Which of the following best explains why aerobic respiration is more energy efficient than anaerobic respiration?
    14·1 answer
  • PLS HELP ME WITH THIS ASAP
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!