1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alexus [3.1K]
3 years ago
7

Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:

Biology
1 answer:
Kryger [21]3 years ago
4 0

agcgggaugagcgcauguggcgcauaacug
You might be interested in
What must be broken for a DNA strand to separate?
ipn [44]
Hydrogen bonds connecting base pairs must be broken.
3 0
3 years ago
I NEED HELP PLEASE <br> How many moles of water are produced if you harvested 182 g of water
shusha [124]

Answer:

10.11 moles

Explanation:

formula

n=m/Mr

8 0
3 years ago
Which of the following is true of all greenhouse gases?
My name is Ann [436]
<span>Which of the following is true of all greenhouse gases?
</span>
C. THEY TRAP ENERGY IN THE ATMOSPHERE.

They are not naturally occurring. They are the result of human activity like using electricity, burning fuel, etc. 

They don't exist in fixed quantities and they don't reflect incoming radiation. The volume of greenhouse gases emitted depends on the activity done. It also does not stay in one place, it moves around and combines with other green house gases; trapping heat in the atmosphere and making the Earth warmer.
6 0
3 years ago
Read 2 more answers
Which biome is an animal with thick fur best suited for
Semmy [17]
The arctic/polar biome
hope it helps
8 0
3 years ago
Read 2 more answers
Look at the bar graph again.
fenix001 [56]

Answer:

Explanation:

I need to see the graph please

8 0
3 years ago
Read 2 more answers
Other questions:
  • A student sets up a controlled experiment to test the effect of a fertilizer on plant growth. They use 2 tomato plants, one is g
    6·1 answer
  • What produces variable traits depending on environmental conditions
    14·1 answer
  • PLEASE HURRY YOU WILL GET 99 POINTS explain how musculs are effected in space and what's inporten of international space
    8·2 answers
  • Who is your crush? this is for a sociology project pls dont ban me<br> ФωФ
    7·2 answers
  • In which culture is a young adolescent given instructions about how to please a girl and bring her to orgasm?
    14·1 answer
  • Most of the lymph returns to the venous circulation by way of the ______.
    13·1 answer
  • HIV weakens the immune system by killing
    14·1 answer
  • .If a cell does not have ribosomes, which of the following molecules is DIRECTLY
    14·1 answer
  • Explain the process of development of embryo in mother's womb. *
    5·1 answer
  • What are the use of Land?​
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!