1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alexus [3.1K]
3 years ago
7

Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:

Biology
1 answer:
Kryger [21]3 years ago
4 0

agcgggaugagcgcauguggcgcauaacug
You might be interested in
If the forces acting upon an object are balanced, then an object MUST
In-s [12.5K]

Must be moving at a constant velocity

Hope this helps :)

4 0
3 years ago
Read 2 more answers
Somatic motor neurons are used to transmit motor signals to muscles. For example, a somatic motor neuron carries a signal from y
Andru [333]

Answer:

Dendrites, cell body, axon hillock, axon, synaptic terminals, biceps brachii.

Explanation:

Neurons are the structural and functional unit of the nervous system. The neurons helps in the transmission of nerve impulse in the body. Two main types of neuron are somatic neuron and motor neuron.

The signal is first reach to dendrites. From the dendrites, the signal transmit to the cell body and then to the axon hillock. The signal then transmits to the axon. At the end of neuron the message is transmitted to the synaptic terminal. The nerve impulse finally reaches to the biceps brachii and results in the flexion of the arm at the elbow.

6 0
3 years ago
Darwin thought that significant evolution was much too slow to be witnessed in a human lifetime. recent experiments by biologist
Ede4ka [16]

Significant evolution, in Darwin's opinion, moves much too slowly to be seen in a person's lifetime. Recent biological tests have demonstrated that some populations may develop extremely quickly, with significant changes happening over many generations in the lab.

What role does Darwin's theory of evolution play?

  • Charles Darwin, a scientist of the 19th century, investigated the idea of natural selection. Natural selection provides an explanation for how a species' genetic features might evolve through time. This might result in speciation, or the creation of a new, separate species.
  • The genesis and adaptations of species entered the scientific canon with Darwin's finding of natural selection. The adaptive characteristics of creatures might now be explained by natural processes, much as the occurrences of the inanimate universe, without the need for an Intelligent Designer.

Learn more about Darwin here:

brainly.com/question/14353066

#SPJ4

6 0
1 year ago
The diagram shows a bacterial cell. How is this cell different from a typical 1 point
Lostsunrise [7]
<h3><em><u>C.</u></em><em><u> </u></em><em><u>This cell has no nucleus.</u></em></h3>

Because bacterial cell do not have a well-defined nuclear membrane. The coiled DNA particles lie naked in the cytoplasm. This is called nucleoid. While in animal cells the nucleus is surrounded by a well-defined nuclear membrane.

8 0
3 years ago
Which of the following is true regarding extinction?
bija089 [108]
I would say that B) single events or several causes working together to produce extinction in a short period is referred to as mass extinction, but I am not 100% sure. 
4 0
3 years ago
Read 2 more answers
Other questions:
  • 1. metal moderate ability to conduct heat and electricity; solid at room temperature; reacts with other elements 2. nonmetal gas
    13·1 answer
  • BRAINLIEST ASAP!<br> How do atoms react with other atoms to create compounds?
    5·2 answers
  • What structures of an electron microscope are comparable to the following requirements for the light microscope: (a) light waves
    11·1 answer
  • Which of the following does not occur during mitosis? A centrometers B chromosomes replicate C spindles form
    10·2 answers
  • A flashlight is to battery as your body is to: a. body heat. b. your eyes. c. your stomach. d. food.
    6·2 answers
  • How can high temperature lead to death
    13·2 answers
  • Anything that occupies space and takes up mass
    12·2 answers
  • What is a template for a rna sequence
    15·1 answer
  • Which trait is always expressed when present?
    11·1 answer
  • Individuals in a population that have traits or abilities that give them a competitive advantage over other population members a
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!