1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alexus [3.1K]
3 years ago
7

Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:

Biology
1 answer:
Kryger [21]3 years ago
4 0

agcgggaugagcgcauguggcgcauaacug
You might be interested in
Which of the following could result in the extinction of a species?
mylen [45]

Increased population size will result in the extinction of a species of organisms.

<h3>What is Extinction?</h3>

This is defined as the dying out or disappearance of species as a result of various factors.

When population size increases, it leads to unavailability of food and reduction of species due to starvation and death.

Read more about Extinction here brainly.com/question/1027555

#SPJ1

7 0
2 years ago
In a topoisomerase reaction, the _____ is used as the first nucleophile and the _____ is used as the second nucleophile.
Alchen [17]

Answer:

a. hydroxyle in tyrosine

b. 3' OH

Request: Please mark me as the Brainliest.

8 0
2 years ago
Why does water need a protein channel to move across the cell membrane?
KatRina [158]
Because it is polar and it is to large to cross the membrane and because the concentration gradients are to strong so they have to be diffused.
hope it helps
please mark as brainliest
6 0
3 years ago
What challenges would you expect scientists to face when growing plants in space? What challenges will the astronauts have with
DanielleElmas [232]

Answer:

the challenges they would expect to see is the plants not having water or air

planted need water to have photosynthesis and since theres no water in space and little to no atmosphere the plants would suffocate

4 0
3 years ago
Which serves as a shell or skeleton for plant 
nataly862011 [7]
Cellulose serves as a skeleton for plants
3 0
3 years ago
Other questions:
  • When plants absorb and incorporate nitrogen into the soil it is called
    11·1 answer
  • Dissociation is quite common and presents in various forms of temporary distraction or separation. When the separation becomes s
    12·1 answer
  • Explain why the type of energy is different for photosynthesis and respiration.
    6·1 answer
  • Water is one of the required reactants for photosynthesis. It provides electrons which are energized by sunlight and used to mak
    9·2 answers
  • Claim-Evidence- Reasoning (CER)<br><br> Question: Are humans made of stardust?
    11·1 answer
  • Why has Mars been more studied with telescopes than Jupiter
    9·1 answer
  • When a negatively charged balloon is used to charge a neutral object by contact, the resulting charges are as
    5·1 answer
  • Which of the following is a specialist species?
    8·2 answers
  • What is the meaning of cycle​
    7·1 answer
  • Question 12 Multiple Choice Worth 5 points)
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!