1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Andreyy89
3 years ago
10

Which two basic emotions combine to create the emotion of contempt?

Biology
1 answer:
julsineya [31]3 years ago
8 0
Disgust+anger= contempt
You might be interested in
Describe the structure of a phospholipid and a phospholipid bilayer. Indicate the polar and nonpolar parts of the structure for
goldenfox [79]
There are two important regions of a lipid that provide the structure of the lipid bilayer. Each lipid molecule contains a hydrophilic region, also called a polar head region, and a hydrophobic, or nonpolar tail region
4 0
3 years ago
Name four abiotic factors found in a prairie ecosystem? Please help me fast as you can...
Mekhanik [1.2K]
Four abiotic factors in a prairie ecosystem would be soil, climate/temperature, water, and oxygen. Hope this helps!
7 0
3 years ago
What would happen to the size of the carnivore population if the herbivore population increased?
Korvikt [17]
<span>The correct answer should be that the carnivore population would also increase. Since they eat the herbivores, if the amount of herbivores increased there would be more food for the carnivores so they wouldn't have to worry about anything and could thrive, feeding themselves without worrying for food.</span>
6 0
3 years ago
Read 2 more answers
Name two types of proteins that regulate the cell cycle. How do these proteins work?
natka813 [3]

Answer:

Internal and external regulators are two types of proteins that regulate the cell cycle. Internal regulators allow the cell cycle to proceed only after certain events occur. External regulators speed up or slow down the cell cycle.

Explanation:

I hope this helps :)

3 0
3 years ago
Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
Kryger [21]

agcgggaugagcgcauguggcgcauaacug
4 0
3 years ago
Other questions:
  • What type of blood do reptiles and amphibians have? If it depends on species please right them down.
    6·1 answer
  • Synthetic compounds found in an organism but not normally produced or expected to be present in that organism are called _____.
    7·1 answer
  • Disease-causing organisms that are so small they can only be seen through a microscope ?
    6·1 answer
  • When looking at periods, which of the following are increasing?
    7·1 answer
  • The person holding the bow and arrow has now let go. The arrow shoots forward toward its target. What type of energy is being de
    13·2 answers
  • How does the table support the information in the main body of the passage?
    10·1 answer
  • 1. What process breaks up rocks?
    10·2 answers
  • Why does DNA replicate itself?
    14·1 answer
  • If all cells contain the same DNA, how does the function and appearance of cells differ?
    10·1 answer
  • Newton solved the problem of what holds the solar system together. How did this change the view of the universe?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!