1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Norma-Jean [14]
3 years ago
10

How can mutations affect evolutionary processes? A) Mutations are novel genes that increase an organism’s fitness in the environ

ment. B) Mutations are new genotypes that cause an organism to be more poorly fit due to non-functional essential genes within its genome. C) Mutations are changes in the genome that can code for new phenotypes that may be selected for or against by the environmental pressures. D) Mutations are changes to protein structure that create new genotypes that can be selected for or against by the environmental pressures.
Biology
1 answer:
Fed [463]3 years ago
5 0

Answer:

Option C

Explanation:

Option A is incorrect as mutations may be detrimental to the organism and are not always beneficial. Option B is incorrect as there are instances where mutations may enable organisms to be better adapted to the environment. Option D is incorrect as genotypes are not selected for or selected against by environmental pressures, it is only the phenotype (exhibitable/ visible traits) that can be selected for or against, hence option C is the answer.

You might be interested in
To help restore nitrogen to the soil, fields should occasionally be planted with what
mixas84 [53]
Fertilizer is high in nitrogen
3 0
3 years ago
Read 2 more answers
An enzyme is a protein that
andreev551 [17]

Answer:

?

Explanation:

need the rest of the question

5 0
2 years ago
Which one is it A, B, or C
Bond [772]

Answer:

B

Explanation:

7 0
3 years ago
Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
trapecia [35]

Answer:

idk

Explanation:

im very sorry about this but i dont know the answer

7 0
3 years ago
Suppose the DNA strand from the question above was exposed to
Nana76 [90]

Answer:

Substitution

Explanation:

Substitution

7 0
3 years ago
Other questions:
  • The three basic types of muscles are -------- or smooth, ------- or skeletal, and ----------
    11·1 answer
  • Describe the makeup of volvox
    9·1 answer
  • A population is experiencing exponential growth. This means it is growing _____, then _____. slowly slowly first, then rapidly r
    9·2 answers
  • What is one way a mountain might form
    15·1 answer
  • A sperm cell and an egg cell combine to form a cell called a zygote. This zygote undergoes cellular division repeatedly to becom
    8·1 answer
  • Carbon absorbs energy at a wavelength of 150. nm. The total amount of energy emitted by a carbon sample is J. Calculate the numb
    15·1 answer
  • Are endocytosis and exocytosis forms of passive or active transport
    15·1 answer
  • Identify the main role of mitochondria in animal cells.
    13·1 answer
  • Which of the following is not a function of a plant root?
    15·1 answer
  • The atlantic cod (gadus callarias) is a fish which lays about 5 000 000 eggs in its lifetime. On average, only two of these eggs
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!