1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
hodyreva [135]
3 years ago
10

Which of the following is an example of a decomposer? mold grass spider eagle

Biology
1 answer:
irinina [24]3 years ago
7 0
Mold is an example of a decomposer
You might be interested in
Does any tundra<br> lie within the United States?<br> If so, where?
JulsSmile [24]

Answer:

Parts of the U.S. state of Alaska and the countries of Canada, Greenland, Iceland, Norway and Russia are all in the Arctic tundra biome. Regardless of how cold and bleak the weather may be in the northern contiguous states in the middle of winter, technically, the tundra does not extend below northernmost Canada

Explanation:

4 0
4 years ago
If a woman with vaginal bleeding reports syncope, the EMT should assume that she: Select one: a. has an ectopic pregnancy. b. is
sergiy2304 [10]

If a woman with vaginal bleeding reports syncope, the EMT should assume that she "is in shock".

<u>Option: B</u>

<u>Explanation:</u>

The most common form of syncope is the Vasovagal syncope. It is triggered by a dramatic drop in blood pressure, resulting in a decline in blood flow to the brain. When one stand up, gravity causes blood to settle down below one's diaphragm, in the bottom part of their body.

It is a component of a wider class of medical conditions which may lead in TLOC involving postural orthostatic tachycardia syndrome (POTS), orthostatic hypotension and neurologically mediated syncope (NMS). The overlapping of such clinical symptoms causes confusion about the category of syncopes which may complicate assessment approaches and present difficulties for diagnosis and treatment, especially in young women.

8 0
3 years ago
Which list correctly alligns the levels of organisms from the least to the most complex​
zepelin [54]

Answer:

cell > tissue> organ> system

Explanation:

6 0
3 years ago
What happens after mRNA<br> leaves the nucleus?
belka [17]

Answer: It goes to the ribosome for translation to occur. The ribosome is located in the cytoplasm.

6 0
2 years ago
What kind of effect can a chromosomal change can have on an organism?
SOVA2 [1]

Answer:

<u>positive, negative, or no effect</u>

Explanation:

The kind of effect that a chromosomal change can have on an organism is either positive, negative, or no effect.

The 3 main chromosomal disorders seen in humans are :

  1. <u>Down's Syndrome</u>
  2. <u>Klinefelter's Syndrome</u>
  3. <u>Turner's Syndrome</u>
6 0
2 years ago
Other questions:
  • Suppose two independently assorting genes are involved in the pathway that determines fruit color in squash. these genes interac
    6·2 answers
  • Help as fast as possible please will give brainlist
    5·1 answer
  • C2H12O6 is a type of
    15·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • What is the normal respiration rate for horses, in breaths per minute?
    5·1 answer
  • 6. How did Darwin think plants and animals had originally come to the galapagos islands?||
    12·2 answers
  • The photos shown below illustrate a case of synpolydactyly, a genetic abnormality characterized by two phenotypes: partially or
    13·1 answer
  • What is silicon, oxgyen, aluminum chemical composition. A. crust B. mantle C. cores​
    9·1 answer
  • Choose the correct statement below.
    11·1 answer
  • 6. Which of the following is a nonmetal?<br> a. Fe<br> b. AI<br> C. N<br> d. Si
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!