1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
r-ruslan [8.4K]
3 years ago
13

Are the bacteria that cause bad breath aerobes or anaerobes?

Biology
1 answer:
erik [133]3 years ago
6 0
The answer is “anaerobes”
You might be interested in
Hey guys im having troubles with this! could anyone please help me with it, if so that would be great and ill give you a brainli
Leona [35]

Answer: the answer is glucose you are correct

Explanation:

hope it helped and did you get it wrong

4 0
3 years ago
Occurs when the body receives antibodies from another source, such as a child receiving antibodies from its mother
ValentinkaMS [17]

Answer:

Innate immunity

Explanation:

Innate immunity is also referred to as inherited or natural immunity. It is the type of immunity that one is born with. It is passed on from mother to offspring. This form of immunity is non-specific as it offers protection from many types of antigens.

8 0
3 years ago
Which of the following characteristics of living things explains why plants bend and grow towards a light source?
Dafna11 [192]
I believe the answer is B. they respond to stimulli
5 0
3 years ago
55 POINTS PLS HELP
Cerrena [4.2K]

Answer:

2, 4, and 5 refers to scientific revolution while on the other hand, the remaining statements shows scientific observation.

Explanation:

Cloning has the potential to  significantly benefit a great many  people, so it should not be  considered immoral or risky is refers as scientific observation.

A scientist thinks that he might  find serious inconsistencies in the  fossil record if he conducts an  excavation in a new location is refers scientific explanation because explanation is needed for it.

The rocks present in western Africa  and eastern South America formed  at the same place and at the  same time is scientific observation because the scientists takes the data.

Even if modern organisms are  found in ancient portions of the  fossil record, this wouldn't challenge the theory of evolution in any way is refers to scientific explanation.

The cloning of organisms is an  exciting area of study, and more  resources should be be devoted  to it so it is refers as scientific explanation.

The age, type, and composition of  ancient rocks in western Africa are  nearly identical to the age, type,  and composition of rocks in  eastern South America is scientific observation which is taken by the scientist through research.

8 0
3 years ago
How are birds and reptiles similar?
labwork [276]
Like all other reptiles, birds have scales. Also, birds lay eggs like other reptiles.
4 0
3 years ago
Read 2 more answers
Other questions:
  • Btx depolarizes the membrane and prevents repolarization. what effect would this have on electrical signaling by the nervous sys
    10·2 answers
  • Right ventricular pressure is always the same as left ventricular pressure true or false
    10·1 answer
  • How many alleles are there for the four main types of human blood?
    6·2 answers
  • After suffering a brain injury by falling from a ladder, Zack's wife continues to tell the doctor that his personality has chang
    10·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Which one answer is not a way to build a sustainable food system?
    15·1 answer
  • Adrenal glands in males release<br> , which are secreted during puberty.
    14·1 answer
  • Which of the following statements are true
    6·1 answer
  • Which of the following is an example of a tertiary consumer?
    12·1 answer
  • Consider the functions of the kidney in the urinary system and the blood vessels in the circulatory system. what tissue type is
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!