1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
elena-s [515]
3 years ago
11

Which statement is false concerning lactic acid?

Biology
1 answer:
vesna_86 [32]3 years ago
8 0

Answer:

<h3>is formed when hydrogens combine temporarily with pyruvate..</h3>
You might be interested in
N a forest ecosystem, 24 gray wolves live together. These 24 wolves make up a 
Ray Of Light [21]
A because it is just one pack making uo the wolf population of that one area
7 0
4 years ago
Read 2 more answers
What is the best conclusion to make from this observation
kari74 [83]

The answer will be A

8 0
3 years ago
How to write letter to leader of civil society<br>​
Stolb23 [73]
Outline four key levers the next government can use to help the sector achieve greater impact for communities up and down the country
5 0
3 years ago
Read 2 more answers
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
Fever is the most serious symptom of a systemic infection.<br><br> True<br> False
Andrei [34K]

Answer:

true

Explanation:that going to be the first symptom you first get when your sick.

3 0
3 years ago
Other questions:
  • Contrast the electrons transport chain in photosynthesis with cellular respiration by identifying the source of the high energy
    11·2 answers
  • number these in order: 1 rise of angiosperms 2. 2 rise of gymnosperms 3. 3 rise of bryophytes 4. 4 rise of chemoautotrophs and p
    15·1 answer
  • What is a natural section
    6·2 answers
  • When automobiles burn gasoline, they release many pollutants including sulfur oxides into the air. the release of sulfur oxides
    10·1 answer
  • Can you provide an example of a disease that is a result of autonomic nervous system imbalances? Explain.
    14·1 answer
  • The largest amount of groundwater is used for _______.
    12·1 answer
  • What are the most common causes of agriscience accidents?
    11·1 answer
  • What is the biggest problem of over use of pesticides
    8·2 answers
  • Q 13.34: Water needs in space flights are easily met through recycling waste water.
    12·2 answers
  • The question is in the picture
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!