1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
OLEGan [10]
3 years ago
11

Which is an example of artificial selection

Biology
2 answers:
vekshin13 years ago
8 0

A. A farmer crosses two kinds of corn. He produces a new, better tasting type of corn.

masya89 [10]3 years ago
8 0
The answer is letter A.
You might be interested in
The gaps of unjoined membrane through which small molecules exit and enter capillaries are called __________.
Dafna1 [17]

Answer:

<h2>A </h2>

Explanation:

1. A channel between two adjacent cells in known as an intercellular cleft.

2. And through these channels many molecules  can easily pass between cells.

3. Importance of Intercellular clefts:

i) It is very important in transportation of fluids and small solutes.  

ii) It contains gap junctions, tight junctions, desmosomes, and adheren proteins and these junctions help in regulate cell communication by signal transduction, surface receptors, or a chemogradient.

8 0
3 years ago
Read 2 more answers
Name any two organisms which do not reproduce sexually
melamori03 [73]

Two examples of organisms who do not reproduce sexually are:

1. Yeast

2. Hydra

7 0
3 years ago
Consider how Photosynthesis and Cellular Respiration are linked. Explain how, together, the 2 processes can be described as a cy
miv72 [106K]
The products and reactants of each cycle are connected. reactants of photosynthesis (6O2 and C6H12O6) are recycled as products in cellular respiration which produces 6H2O 6CO2 and energy to fuel photosynthesis
7 0
3 years ago
Why did scientists eventually choose to support darwin's ideas about natural selection as a mechanism behind evolution rather th
BaLLatris [955]
The correct answer is D. The theory of natural selection provided a better explanation of the processes that were being observed by the scientists.They observed that the related species birds found on one island were slightly different from that of the other, and certain portions earth, have the species, which were not found anywhere else.  
8 0
3 years ago
Red flower color is dominant to white flower color in red roses.what is the expected result of a cross between two heterozygous
OlgaM077 [116]
Heterozygous parents would have the genotype Rr. In a punnett square, this would show a result of 25% homozygous dominant (RR) offspring, 25% homozygous recessive (rr) offspring, and 50% heterozygous (Rr) offspring.
(I attempted to simulate a punnett square with the text)

    <u>  </u><u>R         r    
</u>
<u />R| RR  |  Rr
<u></u>r | Rr   |   rr<u>
</u>
8 0
3 years ago
Read 2 more answers
Other questions:
  • Can someone help me with this question and explain why that answer is right?
    13·1 answer
  • As the masses of two objects decrease, how does the gravitational force between the two bodies change?
    15·1 answer
  • Which parts of photosynthesis occur in the stroma of the chloroplast? Check all that apply.
    8·2 answers
  • What does it mean when it says that aerobic respiration occurs in the cytoplasm “TO” the mitochondria???
    10·1 answer
  • Conduction deafness occurs when sound waves cannot reach the fluids of the inner ear. Which one of the conditions below will not
    14·1 answer
  • Complete the following sentences about prokaryotes. Anaerobic prokaryotes use ___to obtain energy. Archaea and eubacteria are pr
    12·2 answers
  • What is the mRNA in TACCGGATGCCAGATCAAATC?
    5·1 answer
  • HELP! Solar, biomass, geothermal, wind, and hydropower energy are all renewable sources of energy. They are called renewable bec
    9·2 answers
  • Should glyphosate be banned? Why?
    12·2 answers
  • Identify the difference between the distance she walked and her displacement
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!