<span>He will experience a gradual drop in his testosterone levels as he ages. This will cause a lowered amount of energy and could cause a slight gain in weight. In addition, he may experience fatigue, a loss of body hair, and a general decrease in his strength.</span>
Answer:
Mutations during meiosis can often lead to disorders, diseases, etc.
Explanation:Let's say that one of the tetrads formed in the first steps of meiosis It doesn't separate and goes on.
When making gametes, some will contain the necessary amount of chromosomes while others will not
Answer:
B
Explanation:
RNA is ready to make a protein
Explanation:
The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.
1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.
2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.
3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.
In the given question, both promoter sequence are present in the 5'to 3'strand
3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA
The mRNA will be -
5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.
There are two start codon thus two polypeptides will be synthesized.
1. met-thr-asp-ala-val
2. met-thr-asp-val-ala-ser-ser
Answer: B
Explanation:
"Furthermore, ectomycorrhizal fungi can slow down decomposition, a natural process that returns carbon from forest soils back to the atmosphere. In these ways, ectomycorrhizal fungi enhance the ability of forests to keep carbon locked up in trees and soils, and out of the atmosphere." (http://www.bu.edu/articles/2018/4-things-to-know-about-fungi-climate-warriors/)
