1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Gnoma [55]
3 years ago
14

What is an accessory organ of digestion

Biology
1 answer:
Leto [7]3 years ago
3 0

Answer:

An organ that helps with digestion but is not part of the digestive tract. The accessory digestive organs are the tongue, salivary glands, pancreas, liver, and gallbladder.

You might be interested in
HELP ASAP PLEASE!! WILL MARK BRAINLIEST!!!!!
Sergeeva-Olga [200]

Answer:

b i think

Explanation:

8 0
3 years ago
Read 2 more answers
All animals
dmitriy555 [2]
D is the best choice. 
4 0
3 years ago
It’s laundry day at Dan’s house, so he plugs in his electric iron. What transformation of energy takes place inside the iron?
dezoksy [38]

electrical transformation



hope this helps


7 0
2 years ago
Plants are producers because they make their own food from sunlight, _______, and water.
kaheart [24]
Carbon dioxide
this is the answer
7 0
3 years ago
The flow of energy in an ecosystem is best
melamori03 [73]
The flow of energy in an ecosystem is best described as energy moving in one direction from the sun to the producers then to the consumers. 

Explanation; 
Energy flow is the amount of energy that moves through successive trophic levels of a food chain in an ecosystem. Ecosystem maintain themselves by cycling energy and nutrients.
The energy from sunlight is taken up by producers which use it to produce organic compounds through photosynthesis. The energy is then passed successively to the trophic levels, that is from the producers to the consumers ( primary, secondary, tertiary and quotienary consumers). During this transfer some energy is lost at each trophic level in form of heat. 
4 0
3 years ago
Read 2 more answers
Other questions:
  • Among cattle, having horns is a recessive trait. Cattle without horns, which are called polled cattle, are common. Suppose a hor
    13·2 answers
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • What is a sharks' skin made of?
    14·1 answer
  • Which would be classified as a pollutant?
    11·2 answers
  • Which of these is a way climate change positively affects organisms?
    7·2 answers
  • Which statement best describes the hydrosphere?
    10·1 answer
  • Why why why why whywhy
    7·2 answers
  • What is the purpose of the Cell Cycle Checkpoints?
    7·2 answers
  • What is the difference between the muscle in your heart and the muscles in your hand?
    10·2 answers
  • What does a eukaryotic cell have that a prokaryotic cell does not?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!