Answer:
Evolution and diversity result from the interactions between organisms and their environments and the consequences of these interactions over long periods of time. Organisms continually adapt to their environments, and the diversity of environments that exists promotes a diversity of organisms adapted to them.
Explanation:
Answer:
Explanation:
In the DNA, the nitrogen bases, Adenine A (a purine) forms double bond with Thymine T (a pyrimidine) but in RNA, the bond is with Uracil U (a pyrimidine) instead of Thymine; Guanine G (a purine) forms triple bond with Cytosine C (a pyrimidine): this also occur in RNA. This we have:
DNA sequence: 5' ATGCGTAGCCTAGCCTAGTAGCCTTC 3'
Complimentary strand : 3' TACGCATCGGATCGGATCATCGGAAG 5'
The RNA sequence is produced running from the 5' to the 3' direction thus, the complimentary strange will be used.
5'AUGCGUAGCCUAGCCUAGUAGCCUUC 3'
Answer:
The correct answer is b) When a plant cell is placed in concentrated salt water, water moves out of the cell.
Explanation:
Osmosis is the movement of solvent molecules from an area of less concentration of solute to high concentration of solute to equalize the concentration of both the side of the cell.
So water will move outside the cell when any cell will be placed in a concentrated salt water because the concentration of solute is high in salt water and low inside the cell.
Therefore when a plant cell is placed in salt water the osmosis of water takes place from inside to outside the cell. So the right answer is b.
A thermoacidophile are the organisms which are adapted to survive at high temperatures and acidic pH. Thermoacidophiles generally prefer the temperature range of about 70 - 80
o
C and pH between 2 and 3. They are found in the hot springs and thermal vents.
