Answer:
safari could help, learnt this a few years ago, totally forgot!!
Explanation:
:).
Explanation:
The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.
1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.
2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.
3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.
In the given question, both promoter sequence are present in the 5'to 3'strand
3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA
The mRNA will be -
5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.
There are two start codon thus two polypeptides will be synthesized.
1. met-thr-asp-ala-val
2. met-thr-asp-val-ala-ser-ser
I think the correct answer would be A. The yolk sac becomes the placenta. It is membranous sac that is attached to the embryo. It provides all the nutrition and the blood cells needed by the embryo. It is also called the umbilical vesicle.
Answer:
Both have two circuits for circulation.
Explanation:
- The two circuits of circulations are known as the systemic circuit and the pulmonary circuit.
- In the<u> systemic circuit</u> oxygenated blood from the heart is pumped to all parts of the body through the blood vessels and then the blood is pumped back to he heart.
- In the<u> pulmonary circuit</u> deoxygenated blood from all parts of the body is pumped from the heart to the lungs to be oxygenated and after it is oxygenated it is pumped back to the heart.
Once the alcohol goes into our system, an ounce of it is process for a period of one hour.
The first stop happens in the stomach where absorption through the gastric lining and bloodstream occurs. Stronger drinks are absorbed more quickly. The second stop happens in the brain where its function decreases/ is increasingly impaired as the BAC or blood alcohol content grows. The third stop will be in the heart. However, it should be noted that it does not receive any physical alcohol, but its effects on the heart are strong. Alcohol is a vasodilator which means it causes blood vessels to dilate. This indicates more blood flow through the body-- but lowers the overall blood pressure. The fourth stop will be in the kidneys where blood is filtered. The fifth stop will be in the bladder where it will excreted from the body. Lastly, the liver is where the rest of alcohol left in your system is broken down. This process is known as metabolizing. The chemical that remains after metabolization is acetaldehyde and the body gets rid it by further metabolizing it into carbon dioxide and water.
Therefore, an ounce of alcohol is processed in our body for 60 minutes or one hour.