1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Amanda [17]
3 years ago
10

A scientist discovers a new organism living deep beneath the earth surface this organism thrive despite intense pressure heat la

ck of water and sunlight this organism is probably a
Biology
1 answer:
kompoz [17]3 years ago
7 0

Answer:

The organism that can live deep beneath the earth surface despite intense pressure heat lack of water and sunlight might be Nematodes.

Explanation:

  • Nematodes are able to cope extreme heat or extreme cold and dehydration. They have adopted by learning technique that allows them to survive. They can transform into a hardy form called the dauer stage.
  • They can survive harsh conditions for longer durations at this stage. And again awaken themselves when conditions are favourable again.
  • They can be found in hot springs, deserts, high up mountains and in the deepest oceans.

You might be interested in
!!!!!!H-E-L-P!!!!!!!!!! How do index fossils help scientists establish how old rocks and other fossils are? In your answer, incl
ratelena [41]

Answer:

safari could help, learnt this a few years ago, totally forgot!!

Explanation:

:).

3 0
2 years ago
Find the prokaryotic promoter sequences; Draw boxes around them, Circle the start codon. Then transcribe the following DNA seque
Degger [83]

Explanation:

The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.

1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.

2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.

3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.

In the given question, both promoter sequence are present in the 5'to 3'strand

3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA

The mRNA will be -

5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.

There are two start codon thus two polypeptides will be synthesized.

1. met-thr-asp-ala-val

2. met-thr-asp-val-ala-ser-ser

7 0
3 years ago
The ______ becomes the placenta. a. yolk sac b. chorion c. amnion d. allantois
LekaFEV [45]
I think the correct answer would be A. The yolk sac becomes the placenta. It is membranous sac that is attached to the embryo. It provides all the nutrition and the blood cells needed by the embryo. It is also called the umbilical vesicle.
3 0
3 years ago
One feature that amphibians and humans have in common is
Ipatiy [6.2K]

Answer:

Both have two circuits for circulation.

Explanation:

  • The two circuits of circulations are known as the systemic circuit and the pulmonary circuit.
  • In the<u> systemic circuit</u>  oxygenated blood from the heart is pumped to all parts of the body through the blood vessels and then the blood is pumped back to he heart.
  • In the<u> pulmonary circuit</u>  deoxygenated blood from all parts of the body is pumped from the heart to the lungs to be oxygenated and after it is oxygenated it is pumped back to the heart.
8 0
3 years ago
How long does it normally take to process one 12-ounce beer from your system?
Darina [25.2K]

Once the alcohol goes into our system, an ounce of it is process for a period of one hour.

The first stop happens in the stomach where absorption through the gastric lining and bloodstream occurs. Stronger drinks are absorbed more quickly. The second stop happens in the brain where its function decreases/ is increasingly impaired as the BAC or blood alcohol content grows. The third stop will be in the heart. However, it should be noted that it does not receive any physical alcohol, but its effects on the heart are strong. Alcohol is a vasodilator which means it causes blood vessels to dilate. This indicates more blood flow through the body-- but lowers the overall blood pressure. The fourth stop will be in the kidneys where blood is filtered. The fifth stop will be in the bladder where it will excreted from the body. Lastly, the liver is where the rest of alcohol left in your system is broken down. This process is known as metabolizing. The chemical that remains after metabolization is acetaldehyde and the body gets rid it by further metabolizing it into carbon dioxide and water.

Therefore, an ounce of alcohol is processed in our body for 60 minutes or one hour.

7 0
3 years ago
Other questions:
  • Form a hypothesis: You observe mold growing in one side of a slice of bread, but not on the other side. Form a hypothesis to exp
    14·2 answers
  • On the first day after a right pneumonectomy, a client suddenly sits straight up in bed. The client's respirations are labored,
    12·1 answer
  • Which of these molecules is not a product of the Electron Transport System?
    13·1 answer
  • What are two limits to cell growth
    15·1 answer
  • Where do the products of photosynthesis come from? a. we exhale them b. plants c. we inhale them d. animals e. a chemical reacti
    7·1 answer
  • Which process has evolved to yield the GREATEST variation of offspring?
    13·2 answers
  • Which gas has recently increased in the mesosphere, creating a rise in water vapor which has led to the formation of high-altitu
    14·1 answer
  • Explain why a hydrocarbon like benzene can enter the skin with little difficulty and is dangerous inside the body, but an acid l
    15·1 answer
  • In a hypothetical population's gene pool, an autosomal gene, which had previously been fixed, undergoes a mutation that introduc
    7·1 answer
  • According to the diathesis-stress model, a person with a genetic profile of overall resilience would be less likely to develop P
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!