1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Karo-lina-s [1.5K]
4 years ago
11

Which is an example of a lipid?

Biology
2 answers:
Vika [28.1K]4 years ago
8 0
Saturated Fat is one example
Sergio [31]4 years ago
4 0

Fatty acids, oils.  It can be soaps, detergents, waxes. etc.


You might be interested in
1. Rhizobium has symbiotic association with
kolezko [41]

Answer:

any one got snap??

Explanation:

4 0
3 years ago
Changes in a DNA sequence that affect genetic information are known as
mojhsa [17]
Changes in a DNA sequence that affect genetic information are known as mutations.
3 0
3 years ago
Read 2 more answers
Choose elements that classify the iroquois constitution as a primary-source document.
fgiga [73]
<span>The Iroquois constitution is a document known as the "Great Binding Law", also known as the "Great Law of Peace." He law is best described as a tree. The tree is then used to Interpret the law, by using the many uses of the tree in metaphors. The shade, roots and leaves all signify certain aspects of the law, explains how the tree can represent peace among the 5 nations.</span>
3 0
3 years ago
Read 2 more answers
Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
Alla [95]

Answer:

GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong

8 0
3 years ago
A trait that confers a greater level of fitness, relative to those who lack it, is called a(n) ________.
densk [106]

Answer: Adaptation

Explanation:

The adaptation is the process by which a species becomes fitted to its environment which is a direct result of natural selection.

The traits that best suits the organism in an extreme conditions and helps in better survival is known as adaptation.

The variation in the species can be favored or rejected based on the condition. If the variation helps in survival of the organism in a better way then it is favored and if it is does not favors its survival then it is not carried further.

The best suited character is adapted and carried forward.

6 0
3 years ago
Other questions:
  • If two organisms are in the same phylum, then which of these statements is correct?\
    11·1 answer
  • What would happen if diploid organisms reproduced by sexual reproduction without first producing sex cells through meiosis?
    12·1 answer
  • Gland that secretes through ducts to the surface of an organ or tissue or into a vessel is called
    8·2 answers
  • The image shows groundwater zones. Top to bottom: Porous rock or soil, Water, Impermeable rock. Zone 1 is at the top of porous r
    14·2 answers
  • How long did it take for the population to double once again?
    14·1 answer
  • The decimal reduction time (DRT) to kill 90% of cell present for autoclaving a culture is 1.5 minutes. How long would it take to
    8·1 answer
  • Process in sexual reproduction in which male and female reproductive cells join to form a
    11·1 answer
  • Would the animal/ cheek cells normally be attached to one another. Explain your answer
    5·1 answer
  • What is the nuclelus funcion?
    12·2 answers
  • The modern seed plant phyla of ginkgos, cycads, conifers, and gnetophytes are collectively known as?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!