A thick tree ring indicates which of the following

Biology

2 answers:

Trava [24]3 years ago

7 0

The correct answer is option A, that is, the year was good for growth.

In the regions where the length of the growing season is the restricting element, the thickness of the rings of the tree can suggest that when the growing time was lengthier (at the time of warmer times) and when the growing seasons were shorter (cooler times). The study of the development of the rings of the tree is called dendrochronology.

insens350 [35]3 years ago

6 0

The correct answer is option A, that is, the year was good for growth.

Further explanation:

The science in which the rings of the trees is studied is known as dendrochronology. The number of rings present in the trunk of the tree determines the age of the tree. Each year an extra layer of cells is added to the trunk of the tree. The thickness of the tree is determined by the climate of the area in which the tree grows.

During the spring and early summer season, there is quick growth in the bark of the tree which results in the thinner and darker rings in the fall season. During the fall season, there is a prominent slow growth due to which a thicker ring is formed around the trunk.

In the areas and season where the growth of the tree is lengthier, thicker layer of cells can be seen has rings around the trunk of the trees. This occurs mainly in the warmer times of the year. During the cooler times of the year, the season of growth is shorter and does the development of a layer of cells around the trunk is less. This leads to a thin ring.

Learn more:

Learn more about pain killer brainly.com/question/493592
Learn more about parts of the science brainly.com/question/1721226
Learn more about earthliving organisms brainly.com/question/8741712

Answer Details:

Grade: Middle School

Subject: Biology

Chapter: Dendrochronology

Keywords:

Dendrochronology, trees, rings, climate, growth, slow growth, fast growth, trunk, the cooler temperature, season.

You might be interested in

Scientists have studied oceanic plastic garbage "patches" around the world. These are areas that accumulate plastic garbage from

zheka24 [161]

Answer:

b. Clean up plastic trash from shorelines, rivers, and other waterways that flow into the oceans.

Explanation:

Oceanic plastic garbage "patches" are a build up of debris most especially plastic, nylons, waste from wood that was deposited purposely or not purposely( by the wind or ocean waves) into the ocean.

Human activity that would most directly reduce the amount of plastic garbage that enters the ocean includes the cleaning up plastic trash from shorelines, rivers, and other waterways that flow into the oceans.

7 0

3 years ago

Given the DNA sequence -- 5’ CTCTCCCCCGCGGGGGCTGTACTATCATGCGTCGTCTCGGUUAAUUU 3’ determine the mRNA sequence. (N.B. Answer must i

Marat540 [252]

During transcription, a fragment of DNA is used as template to synthesize a complementary mRNA molecule. Subsequently, this mRNA is in turn used as a template to synthesize a protein by a process called translation.

In this case, the complementary mRNA sequence is:

3´GAGAGGGGGCGCCCCCGACAUGAUAGUACGCAGCAGAGCCAAUUAAA 5´

Transcription is a molecular mechanism by which a fragment of DNA (e.g., a gene) is used as a template to synthesize a complementary RNA sequence, usually a messenger RNA (mRNA) sequence.

Subsequently, this mRNA sequence is then used as a template to produce a polypeptide chain in the ribosomes by a process called translation.