1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
AleksandrR [38]
3 years ago
15

Why is watershed management important to maintaining good water quality in a large river or lake?

Biology
1 answer:
Alla [95]3 years ago
5 0
<span>Watershed management is important because surface and storm water runoff always end up draining to other bodies of water. Everything upstream always flows downstream so this has to be taken into account for lakes and rivers. Managing what water goes into the drains and through open sewers is important. Pollutants could easily make their way into rivers, streams and lakes if the watershed is not managed properly by businesses and people alike.</span>
You might be interested in
Help Please Biology!!!! ASAP
Dmitry [639]
I think the answer to this is structure C
3 0
3 years ago
When a cell copies its DNA (replication), the original DNA ladder is broken apart and new nucleotides are added to the center. T
VladimirAG [237]

1. TTGCATGCTAGCTACGTGTACGTACCGATGCG

2. GGGCCCATACGTACATGCATGCAGCATATAGC

3. GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

You should double check those to make sure I didn't make any mistakes. Hope this helps!

5 0
3 years ago
I would really appreciate it if you help me.
Georgia [21]

Answer: H

Explanation:

4 0
3 years ago
Read 2 more answers
Which weather event is typically brief, contains very strong winds, and leaves a path of destruction up to 50 miles long? a cycl
Mashutka [201]

Answer:

Tornado

Explanation:

  • A cyclone:

A cyclone can last on average for 9 days depending upon the forces of wind leading to the decay of the things. It typically effects an area of  typically 30–65 km (20–40 miles). They are characterized by rotating winds around an area of low pressure.

  • A hurricane

It is a form of cyclone called a Tropical cyclone. It is characterized by heavy thunderstorms where winds circulate in a counterclockwise towards the center of earth. These vigorous winds destruct an area of 50 to 100 miles from the point of their origin. They can last from 12 to 24 hours depending upon the speed of wind.

  • A thunderstorm

A thunderstorm is a weather event that can manifest itself in different forms like lightning, Thunder and strong wind, rain, snow. It is a broad term that covers many events like Tornadoes, Floods,Cloud-to-ground lightning and hailing. Depending upon intensity the damage path of a thunderstorm can be from few miles to hundreds of miles.

  • A Tornado

A Tornado is a specific form of thunderstorm that are characterized by strong, rapidly rotating winds that damages a path from one to fifty miles. They last for less than ten minutes so we can say their duration is less than other deadly weather events.


Therefore, Tornado is best option.

3 0
3 years ago
Read 2 more answers
Pointillism is based on the following insight(s) from color theory: a. analogous colors are three colors that are next to each o
andrew11 [14]

Answer:

b. when dots of color are painted close together, the eye combines the dots and sees a single color

Explanation:

Pointillism is a  technique used in painting where the artist places dots close together to ccreate a mix of them that observers experience optically.

I hope you find this infromataion sueful and interesting! Good luck!

6 0
3 years ago
Other questions:
  • A company is testing a new weight-loss supplement. For the study, the company enrolled 189 obese or overweight middle-aged peopl
    10·2 answers
  • Which of the following analogies best describes the motion of a nonmotile protist? . A. A boat is moved forward by several oars.
    7·2 answers
  • Match these items. 1. obtain food from non-living organic material taxis 2. mutually positive arrangement between species radiol
    10·1 answer
  • Diseases carried from person to person through other hosts, such as animals or insects, are known as _____
    6·1 answer
  • Things that elephants do to engineer the ecosystem
    9·1 answer
  • Oxygen enters the nose and follows the path to your lungs. Cilia help keep the oxygen that moves into your lungs clean. Next ave
    10·1 answer
  • Which do all cells need in order to function?
    5·2 answers
  • How might the death of all the producers in a community affect the carbon and oxygen cycle?
    13·1 answer
  • In what ways are
    5·1 answer
  • Which segment of an mrna transcript is removed?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!