1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kipiarov [429]
3 years ago
12

What is a vascular plant? what is a vascular plant?

Biology
2 answers:
klemol [59]3 years ago
4 0

a plant with tissues that carries water

Olenka [21]3 years ago
3 0
A vascular plant is a plant that is characterized by the presence of conducting tissue.
You might be interested in
What is longer an era or epoch
pishuonlain [190]

An epoch is longer than an era.

3 0
3 years ago
bacteria communicates and exchange genetic information through extensions of their cell walls called​
Inessa05 [86]

Answer:

Conjugative Pili

Explanation:

Conjugative Pilli:allows for the transfer of DNA between bacteria, in the process of bacterial conjugation.

7 0
3 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
Is a grasshopper a herbivore carnivore or omnivore
Natali [406]

Answer:

Grasshoppers are a herbivores because they eat plants

Explanation:

5 0
2 years ago
Read 2 more answers
A baking tray is made of metal because it’s of heat. An oven mitt is used to take the tray out of the oven because it’s ______
prisoha [69]
An oven mitt is used to take the tray out of the oven because its insulated, or padded.
4 0
3 years ago
Read 2 more answers
Other questions:
  • based on your observations, how are the chemical properties of iron and glass similar? how are they different?
    13·1 answer
  • The optic nerve is located in which cavity?
    15·1 answer
  • What happens when an antibody binds an antigen
    10·2 answers
  • Sarah and her friend see a sign for gas at exit 5. The next exit is 70 mi away. If they have one fifth of a tank of gas, should
    5·1 answer
  • Which of the following pieces of evidence most strongly supports the idea that all life on Earth evolved from a single ancient c
    14·1 answer
  • How does the nervous system interact with all other systems
    11·1 answer
  • What effect will the settling of sediment have on the shape of the stream?
    10·1 answer
  • Which of the following are examples of natural discharge areas for underground water?
    13·1 answer
  • when you cut an onion, what happens to your eyes? what role do you think the onions' central vacuoles have in your reaction?
    9·1 answer
  • I’ll give brainly + 10 points because till is a long question... List two real-life examples for each diffusion and osmosis, as
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!