1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aalyn [17]
3 years ago
12

Why don’t recessive traits always eventually disappear from populations?

Biology
1 answer:
Iteru [2.4K]3 years ago
5 0
Because the recessive trait might not show, but its there, lets say B is brown eyes and b is blue eyes, BB is brown, Bb is brown, and bb is blue, if B is present, brown will always show, but as long as the little b is there, there is a chance of the kids having blue eyes, sure most people would have brown eyes, but a lot of the people with brown eyes would be Bb
You might be interested in
Question 4 Unsaved
Harman [31]
Provide commercial/recreational opportunities without adversely impacting wild populations (i.e. overharvest).
6 0
3 years ago
Select all that apply. What are the nutrients needed for good health?
Karolina [17]
The are six essential nutrients that are needed for the human body. n essential nutrient is a nutrient that the body cannot synthesize on its own. These nutrients are carbohydrates, protein, fat, vitamins, minerals and water. Hope this answers the question.
8 0
3 years ago
Read 2 more answers
Vascular tissue is important to a plant because it
stiv31 [10]
<span>Vascular plants are able to grow higher than other plants due to the rigidity of xylem cells, which support the plant.</span>
8 0
3 years ago
When Charles Darwin considered wings of birds, he famously propose 1 ): Google. hhmi biointeractive great transition heime 17:28
serg [7]

When Charles Darwin considered wings of birds, apart from his famous proposal he also predicted that fossils will be found with structures that are intermediate between early and modern form.

Answer: Option C

<u>Explanation:</u>

Charles Darwin was basically referring to transitional Fossil while considering Wings of bird. So what are transitional fossil? They are the fossil remains of both the ancestral group and the descendant group.  

Since we don’t have enough record of the fossils, it is very difficult to know the accuracy of transitional fossil.  However, we do have some record of fossils from which we can gather enough evidence of how the fossils where earlier and how it evolved over a period of time.  

7 0
3 years ago
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
3 years ago
Other questions:
  • Which statement best distinguishes an observation from an inference?
    7·1 answer
  • If an organism’s haploid number is 12, its diploid number is
    8·2 answers
  • Environmentalists observed the diminishing of _________ and global warming trends.
    6·1 answer
  • What effect will a decreased heart rate have on blood pressure?
    12·1 answer
  • The process of making rna from dna
    13·1 answer
  • How does carbon dioxide enter the atmosphere?
    6·2 answers
  • Which of the following are the predominant organisms in the food web shown below?
    10·1 answer
  • 1 ) Explain how the surface area and volume of cells affect the rate of exchange of materials in and out of cells in multi cellu
    13·1 answer
  • Plz help me thxs Appreciate
    12·1 answer
  • I need help on this one!
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!