1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Savatey [412]
3 years ago
5

What process changed the genetics of some rabbits over many generations to give them white or spotted fur and to make them frien

dly pets?
A.
natural selection
B.
desensitization
C.
selective breeding
D.
diversification
Biology
1 answer:
irinina [24]3 years ago
6 0
I think it would be selective breeding
You might be interested in
Can some one code this dna
cluponka [151]

Answer:

After replication, identical copy of the Double stranded DNA is produced. Complementary strand for each of stand given below is

Explanation:

 1. AACGTACGATCGATGCACATGCATGGCTACGC

Complementary strand  

     TTGCATGCTAGCTACGTGTACGTACCGATGCG

Protein encode: NVRSMHMHGY

2. CCCGGGTATGCATGTACGTACGTCGTATATCG

Complementary strand  

     GGGCCCATACGTACATGCATGCAGCATATAGC

Protein encode: PGYACTYVVY

3. CGCGATCGAGCGATCGACGAATGCCTAGTTTT

Complementary strand  

   GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

Protein encode: RDRAIDECLV

4. TTAAACGAGCTGCTAGCTATTTTTAAAACCCCG

Complementary strand  

   AATTTGCTCGACGATCGATAAAAATTTTGGGGC

Protein encode: LNELLAIFKTP

7 0
3 years ago
Although allergic reactions are triggered by allergens like pollen and fungi, the actual cause of the symptoms like mucous produ
galina1969 [7]
Although allergic reactions are triggered by allergens like pollen and fungi, the actual cause of the symptoms like mucous production and constricted airways is A) the body's immune response. B) the effect of medical treatment. C) the surrounding weather conditions. D) the clogging effect of the allergens. <span>Although allergic reactions are triggered by allergens like pollen and fungi, the actual cause of the symptoms like mucous production and constricted airways is
A)
the body's immune response.
B)
the effect of medical treatment.
C)
the surrounding weather conditions. </span>
7 0
3 years ago
Read 2 more answers
What does the process of gene duplication and divergence refer to? (select all that apply)?
Debora [2.8K]

It refers to making or crating new genes in form of mutation in duplicates of old genes. It is also a mechanism in major way through new genetic material is generated during evolution. The duplication happens in event termed unequal crossing over or recombination between misaligned homologous chromosomes during meiosis. 

7 0
3 years ago
carolus linnaeus created the linnaean system of classification using 2 latin names to designate each organism
Zepler [3.9K]

Answer:

<em>Carolus Linnaeus devised the binomial nomenclature system under which the organisms were named using their Genus name and Species name. </em>The Genus name was written first, forward by the species name. The system of binomial nomenclature allowed for assigning a scientific name to all the organisms so that the conversations between scientists could be made easier. For example, humans have the scientific name<u><em>,</em></u><em> Homo Sapiens</em>, where Homo is the genus name and sapiens is the species name.

8 0
2 years ago
Why is mechanical digestion and important to chemical digestion
dangina [55]
They are both important because mechanical has to do with physical - cause mechanical means physical, so chewing your mouth is physical (you break your food into smaller pieces physically). And then chemical digestion is when food and saliva mix together. They happen when breaking down food into nutrients - enzymes. Enzymes are important for that process, because they make a nutrient.



Hope this helps!!

6 0
2 years ago
Other questions:
  • How are gems different from regular minerals?
    14·2 answers
  • What do you think would happen if a balloon had twice the mass if you launched it
    11·2 answers
  • Vegetation that grows along the floors of tropical and temperate forests is called undergrowth. How is the undergrowth of a trop
    7·2 answers
  • During an expedition, a scuba diver saw an animal use stinging tentacles to capture and eat its prey. Which animal did the diver
    13·2 answers
  • 5 types of trees quick PLEASE
    13·2 answers
  • How does the declining biodiversity affect us?
    7·1 answer
  • What does an equation that shows water and carbon dioxide combining to form glucose and oxygen represent
    9·1 answer
  • A pear plant with the genotype Aa can produce gametes containing:
    12·1 answer
  • Explain why people with emphysema suffer from shortness of breath​
    10·1 answer
  • You can see some blood vessels on the outside of the hands specially in older people. Are those veins or arteries? How can you c
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!