1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
liq [111]
4 years ago
14

Which of the following offers the best explanation for infantile amnesia? a The accumulation of life experiences disrupts the re

trieval of early life events. b The emotional reactivity of infants inhibits the process of encoding. c Iconic memories last for less than a second in infants. d Birth trauma prevents explicit encoding. e The hippocampus is one of the last brain structures to mature.
Biology
1 answer:
Nookie1986 [14]4 years ago
3 0

Answer:

A. the hippocampus is one of the last brain structures to mature

Explanation:

hippocampus is the part of brain which plays an important role in learning an d memory. AS infantile amnesia is the inability of the person to recall the events occurs between 2 to 4 years and also before the age of 10 with passage of time.

the fast birth of cells in the hippocampus during prenantal period and neurogenesis is responsible for having inability of long lasting memories.

You might be interested in
Question 8 (1 point)
stepan [7]
Answer:

C: Exoskeleton

Explanation:

Unlike humans and other mammals, many insects and crustaceans alike have this tough outer layer that looks similar to a skeleton! This would be identified as its exoskeleton.

I hope this helped my darling!
5 0
3 years ago
How many generations are presented in this pedigree?
kobusy [5.1K]
5 generations I think
5 0
3 years ago
What are the functions of a charbohydtate
shusha [124]
Small amount of energy
5 0
4 years ago
Read 2 more answers
Haploid cells have half the number of chromosomes as the diploid cells within the
4vir4ik [10]

Answer is TRUE.

Haploid cells do in fact have half the cells of Diploid cells. Haploid is basically the sex cells which means it’s the sperm cell ( 23 chromosomes) and the egg ( 23 chromosomes) which equals to 46 chromosomes ergo the Diploid cells.

6 0
3 years ago
Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
erica [24]

Melting temperature of RNA duplex will be higher

Explanation:

  • RNA is a double stranded RNA with two complementary sequences
  • Duplex DNA is simply double stranded DNA
  • It is known A=U base pairs of duplex RNA is less stable than that of A=T base pairs of duplex DNA
  • RNA duplexes are considered to be more stable than DNA duplexes of comparable sequences but physical basis for thermal stability is not much known hence melting temperature of RNA duplex will be higher
5 0
3 years ago
Other questions:
  • The fluid part of the circulatory system is called
    5·1 answer
  • How does nitrogen get recycled back to the atmosphere?
    13·1 answer
  • Mitosis is used to make new ____ cells, such as heart, muscle, and skin cells. Meiosis is used to make new ____ cells. In humans
    8·2 answers
  • Which structure includes all of the others? Select one: a. genes b. chromosomes c. nucleolus d. nucleus
    6·1 answer
  • Please help. Biology question. Question in image.
    14·2 answers
  • An organism lives in a container with very little oxygen. It produces ethanol and carbon dioxide as waste products. Which proces
    15·1 answer
  • What occurs during the transition from stage A to stage B in the picture?
    14·1 answer
  • Why is earth considered an open system and a closed system? (Site 1)<br> O
    7·1 answer
  • 1. En una actividad pedagógica, Luis organiza una dinámica con los estudiantes de Química: para ello quien menos utilice y respo
    6·1 answer
  • Compare TWO ways in which destructive relationships influence your
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!