1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vova2212 [387]
3 years ago
15

Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha

s a melting temperature (tm) of 59 8C. If an RNA duplex oligonucleotide of identical sequence (sub-stituting U for T) is constructed, will its melting temperature be higher or lower?
Biology
1 answer:
erica [24]3 years ago
5 0

Melting temperature of RNA duplex will be higher

Explanation:

  • RNA is a double stranded RNA with two complementary sequences
  • Duplex DNA is simply double stranded DNA
  • It is known A=U base pairs of duplex RNA is less stable than that of A=T base pairs of duplex DNA
  • RNA duplexes are considered to be more stable than DNA duplexes of comparable sequences but physical basis for thermal stability is not much known hence melting temperature of RNA duplex will be higher
You might be interested in
A rooster laid an egg on top of the barn roof. Which way did it roll?
docker41 [41]
Roosters don't lay eyes! :P
5 0
3 years ago
Read 2 more answers
Cơ thể người không tiêu hóa được loại đường nào?
Svetllana [295]

Answer:

Cơ thể người không tiêu hóa được loại đường nào? Cơ thể người không tiêu hóa được Xenlulozo.

5 0
3 years ago
A front roll happens on this plane
nekit [7.7K]
no the front roll doesn’t
7 0
3 years ago
How can driving a car affect the carbon cycle?
alekssr [168]

Hey there, thx for posting your question to Brainly, i've posted some information below and an explanation, hope it helps you<3

Carbon moves from the atmosphere to plants. In the atmosphere, <em>carbon is attached to oxygen in a gas called carbon dioxide (CO2)</em>. Through the process of <u>photosynthesis, carbon dioxide is pulled from the air to produce food made from carbon for plant growth.</u>

<u>Carbon moves from plants to animals. Through food chains, the carbon that is in plants moves to the animals that eat them. Animals that eat other animals get the carbon from their food too.</u>

<u>Carbon moves from plants and animals to soils. When plants and animals die, their bodies, wood and leaves decays bringing the carbon into the ground. Some is buried and will become fossil fuels in millions and millions of years.</u>

<u />

<u>Hey!</u><em> Hope i was able to help, have a good one.</em>

8 0
3 years ago
How is meiosis different from mitosis.
Gemiola [76]

Answer:

the answer is b

Explanation:

at the end of meiosis, each gamite has two full sets of chromosones

7 0
2 years ago
Other questions:
  • A recessive trait is observed when an organism has how many recessive genetic factors
    8·1 answer
  • Will mark bainliest. Why cells small?<br> Hint becose they small
    12·2 answers
  • Which organelles store food and other materials needed by the cell?
    6·2 answers
  • Look at the information presented in the table, above. Based on these results, which allele for each trait is a) dominant? b) re
    13·2 answers
  • Why were some bacteria and viruses were radioactive at the end of the Hershey chase experiment?
    5·1 answer
  • In Oompa Loompas, gray face (G) is dominant to orange recessive face (g). If two gray faced Oompas have an offspring with an ora
    12·1 answer
  • Explain the processes of transcription and translation
    13·2 answers
  • Question- Calculate how many
    13·1 answer
  • Is my backyard considered an ecosystem?
    15·2 answers
  • An organism is a unicellular autotroph, containing chlorophyll. It has a nucleus inside of its cells and contains flagella in or
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!