1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vova2212 [387]
3 years ago
15

Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha

s a melting temperature (tm) of 59 8C. If an RNA duplex oligonucleotide of identical sequence (sub-stituting U for T) is constructed, will its melting temperature be higher or lower?
Biology
1 answer:
erica [24]3 years ago
5 0

Melting temperature of RNA duplex will be higher

Explanation:

  • RNA is a double stranded RNA with two complementary sequences
  • Duplex DNA is simply double stranded DNA
  • It is known A=U base pairs of duplex RNA is less stable than that of A=T base pairs of duplex DNA
  • RNA duplexes are considered to be more stable than DNA duplexes of comparable sequences but physical basis for thermal stability is not much known hence melting temperature of RNA duplex will be higher
You might be interested in
Monosaccharide is to carbohydrates as ________ is to protein
Lana71 [14]

A is the answer please make me the brainliest

4 0
3 years ago
Why are protists like animals ? A. They move and catch their food , B, they move and make their own food , C. They move and are
blagie [28]
<span>A. They move and catch their food </span>
3 0
4 years ago
Whats the distance between the earth and the sun​
mote1985 [20]

Answer:

92.96 million mi

Explanation:

6 0
3 years ago
Read 2 more answers
How do you think greenhouse gas emissions and global climate will change during the next 50 years? If greenhouse gas emissions a
Karolina [17]
Greenhouse gas emissions will continue to increase in the short term, but as new technologies are discovered and implemented by governments and industries, this may eventually reverse. Global climate may continue to warm, but once greenhouse gas emissions are lowered, this may slowly reverse. Current solutions are not yet enough to stop the increase in temperature, but some technologies on the horizon are promising, such as carbon capture and storage, solar energy, and aquaculture of biofuels. One immediate way to reduce greenhouse gas emissions is a change in lifestyle, for example, using less fuel-intensive transportation options and saving electricity.
5 0
3 years ago
Consider the model of the oxygen cycle as it moves through the various spheres of Earth. One assumption we can make after analyz
Afina-wow [57]

Answer:

B)Photosynthesis releases oxygen into the atmosphere while aerobic respiration removes oxygen from the atmosphere.

Explanation:

Only option B satisfies the answer to the question.

We know that photosynthesis is the process whereby green plants manufacture their foods in the presence of carbon dioxide and sunlight. Carbondioxie in the environment is used to manufacture food in plants. The bye product of photosynthesis is oxygen gas. Oxygen gas is used for aerobic respiration in animals and is essential for their life. This way photosynthesis adds to the pool of oxygen in the atmosphere and aerobic respiration removes from the pool.

6 0
3 years ago
Read 2 more answers
Other questions:
  • What are typical signs and symptoms for a urinary tract infection?
    8·1 answer
  • 36. Mammals are exposed to a variety of outside temperatures. However, they are able to
    12·1 answer
  • Differentiate between parental and recombinant gametes.
    9·1 answer
  • Humans can digest starch but not cellulose because _____. the monomer of starch is glucose, while the monomer of cellulose is ga
    9·1 answer
  • Why do arteries need to be thick, muscular, and elastic?
    13·2 answers
  • What are the primary sites of protein production in a living eukaryotic cell?
    8·1 answer
  • A biologist spent many years researching the rate of evolutionary change in the finch populations of a group of islands. It was
    5·2 answers
  • When Edna's great-grandfather returned from World War I, the family recalls that he would sometimes think that he
    15·2 answers
  • Which of these is not a study of science<br> Geography<br> Zoology<br> Botany<br> Biology
    13·2 answers
  • Submit your air quality report for your area, showing seven days, the air quality color for each day, and each day's major pollu
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!