1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vova2212 [387]
3 years ago
15

Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha

s a melting temperature (tm) of 59 8C. If an RNA duplex oligonucleotide of identical sequence (sub-stituting U for T) is constructed, will its melting temperature be higher or lower?
Biology
1 answer:
erica [24]3 years ago
5 0

Melting temperature of RNA duplex will be higher

Explanation:

  • RNA is a double stranded RNA with two complementary sequences
  • Duplex DNA is simply double stranded DNA
  • It is known A=U base pairs of duplex RNA is less stable than that of A=T base pairs of duplex DNA
  • RNA duplexes are considered to be more stable than DNA duplexes of comparable sequences but physical basis for thermal stability is not much known hence melting temperature of RNA duplex will be higher
You might be interested in
A healthy diet gives a ..................​
Marina CMI [18]

Answer:

What constitutes a healthy diet?

A healthy diet is one that helps maintain or improve overall health. A healthy diet provides the body with essential nutrition: fluid, macronutrients, micronutrients, and adequate calories. A healthy diet may contain fruits, vegetables, and whole grains, and includes little to no processed food and sweetened beverages.

Explanation:

8 0
3 years ago
Nellie had four air plants on her desk
hammer [34]

Answer:It’s the independent variable

Explanation:Watering the plant doesn’t rely upon other variables it itself is the variable making it independent

8 0
3 years ago
Complete the analogy below.
posledela
<h2>The answer would be A.</h2>

When there are <em>multiple convection cells in each hemisphere</em>, something called <u>"The Coriolis effect"</u> happens. The defination is basically that the Earth rotates perpendicular to it's axis which is answer A.

Hope this helps!

I used it on my test and it was right.

4 0
3 years ago
Read 2 more answers
Which of the following courses might a mechanical engineer take in college?
nlexa [21]
The answer is d) organic chemistry
3 0
3 years ago
What are some treatments for muscle soreness
barxatty [35]
 Heat can help relieve joint pain<span>. If you get sore muscles once in a while, you can take </span>acetaminophen<span> (</span>Tylenol) or anonsteroidal anti-inflammatory drug<span> (</span>NSAID<span>) like </span>aspirin,ibuprofen<span> (</span>Advil<span>, </span>Motrin<span>), or </span>naproxen<span> (</span>Aleve<span>)to help ease the discomfort. A hot bath may help</span>
7 0
3 years ago
Read 2 more answers
Other questions:
  • The three types of seismic waves produced by an earthquake are primary, secondary, and
    14·1 answer
  • Alright, i am homeschooled and go to keystone homeschool, i am taking 9th grade biology and need someone to check and help me wi
    10·1 answer
  • I'm really confused, how do I friend people?
    6·1 answer
  • What are transitions metals
    9·2 answers
  • This type of injury could cause a lose of
    10·1 answer
  • Which of the following describes an aspect of fetal circulation that does not occur in adult circulation?  Both oxygenated and d
    8·2 answers
  • An energy pyramid is composed of oak trees, rabbits, snakes, and eagles. The producers receive 100% of the total energy from the
    15·1 answer
  • Why do all plants have similar organelles?
    8·2 answers
  • Write at least one paragraph for ways that you can observe nutrient cycling in nature there should be multiple ways to describe
    14·1 answer
  • In earthworms, what do the nerve cord, the setae, the circular muscles, and the metanephridia have in common?.
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!