1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vova2212 [387]
2 years ago
15

Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha

s a melting temperature (tm) of 59 8C. If an RNA duplex oligonucleotide of identical sequence (sub-stituting U for T) is constructed, will its melting temperature be higher or lower?
Biology
1 answer:
erica [24]2 years ago
5 0

Melting temperature of RNA duplex will be higher

Explanation:

  • RNA is a double stranded RNA with two complementary sequences
  • Duplex DNA is simply double stranded DNA
  • It is known A=U base pairs of duplex RNA is less stable than that of A=T base pairs of duplex DNA
  • RNA duplexes are considered to be more stable than DNA duplexes of comparable sequences but physical basis for thermal stability is not much known hence melting temperature of RNA duplex will be higher
You might be interested in
O que a china pode fazer para evitar o estresse hidrico?
irina1246 [14]

Answer:

Explanation:

water stress is used to describe a scenario in which, in a given region, the demand for water is greater than its availability and capacity for renewal. In this type of situation the amount of water available is insufficient to meet the needs of use. A country is considered to be under water stress when water availability is less than 1,700 m 3 per capita per year, according to the UN.

Among the main causes of water stress are: water wastage; population growth and intense urbanization with a consequent increase in the consumption of water for domestic, industrial, agricultural and livestock purposes, among others; water pollution by the discharge of sewage, solid waste, industrial waste and chemical products from agricultural activities; global warming , which directly affects the water cycle ; inequalities in water distribution and poor supply systems.

Water stress can cause water shortages in a number of places. Photo: T.Dallas / Shutterstock.com

Water stress is a reality in many regions of the world and it is estimated that in a short time many other places will be part of this scenario. UN data reveal that by 2025 about two-thirds of the world's population will be living under conditions of water stress. Some regions have even reached the water shortage, such as the Middle East . Among the regions hardest hit by water stress are North Africa , Mediterranean (European and African), Southeast Asia, Northeast China, Australia, United States and Mexico.

Population growth and economic development are the main factors contributing to the increase in water consumption in the world. With this, the amount of water consumed per capita grows more and more, but the amount of this resource on the planet remains unchanged. Most of this economic growth occurs in developing regions, such as Africa and Asia, which already tend to lack water availability. In the case of developed countries, the problem is different: improving living conditions means that per capita water use increases.

With regard to water availability, Brazil is a privileged country, presenting approximately 12% of the world's fresh water. However the distribution of this resource is extremely unequal, with about 68% concentrated in the North region. The Southeast region has only 6% of the country's freshwater reserve. In other words, the most populous regions have the lowest water availability. The Northeast region suffers the most from water stress, since it is the most arid in the country, passing through long periods of drought .

The impacts caused by water stress are many, from environmental and social problems to political and economic ones. It is also worth mentioning the possibility of wars, which had previously occurred only in the case of land, oil or other resources. Possible solutions to avoiding the continuity of the water crisis include the use of technologies that consume less water in irrigation, conscious consumption of water, avoidance of water pollution, waste management and effluent treatment efficiently , improve supply networks, and government action to establish laws and incentives that encourage everyone to realize that water is a limited resource.

References:

Bates, BC et al., Climate Change and Water. Technical Paper of the Intergovernmental Panel on Climate Change. Geneva: IPCC Secretariat, 2008. 224 p.

Mello, MCS 2010. The water crisis in the world scenario: analysis of its causes, consequences and proposition of solutions that make possible the reversion of this situation. Postgraduate Monograph, Instituto A Vez do Mestre, Cândido Mendes University. Rio de Janeiro.

7 0
3 years ago
What type of relationship exists between a bromeliad tree and a strawberry poison dart frog?
Pavel [41]

Answer:

<em><u>mutualism</u></em>

As Mackenzie told us, the mutualism between strawberry poison dart frogs and bromeliads is “evidence of the complexity that exists in the biological world and the interconnectedness of species.”

Explanation:

Hope it helps you..

Your welcome in advance..

(ㆁωㆁ)

3 0
2 years ago
The starfish's water-vascular system is used for locomotion and capturing food. True/False
Ymorist [56]

Answer:

true

Explanation:

3 0
2 years ago
Brad is testing three solutions with litmus paper after dipping strips in the solutions he observes two papers turning blue and
timama [110]
Out of the three, only 1 is acidic because litmus paper turns red in acidic compounds and blue in basic compounds.
7 0
3 years ago
While describing sample processing, the RN refers to the process of inoculation. He explains that the sample is introduced to a
Zigmanuir [339]

Answer:A culture or growth medium

Explanation: A culture or growth medium contains essential nutrients that aids in the growth of microorganisms. A culture medium can be in liquid form or solid form. It is very important to make sure that a culture or growth medium is sterile and free from any form of contamination. The main function and importance of a culture or growth medium is to ensure that microorganisms grow in a sterile environment that has all the major and essential nutrients required for their growth and to preserve them against any form of harm or contamination such that when these organisms are needed they can be used.

6 0
3 years ago
Read 2 more answers
Other questions:
  • Where do clams come from
    11·2 answers
  • A dichotomous key may be used to classify butterflies.
    12·2 answers
  • What determines which stage occurs after a supernova?
    5·1 answer
  • Which of these processes occurs in the chloroplast of a plant leaf?
    6·2 answers
  • About 75% of the earths surface is covered by
    13·2 answers
  • The humanistic perspective emphasized the importance of___. A. reciprocal determinism B. self-determination C. free association
    12·2 answers
  • In science class, Maria observes a white-colored cut flower. She sees that the petals turn red when the flower is sitting in a v
    11·2 answers
  • Which wave has the higher frequency A or B?
    9·2 answers
  • What do scientists mean when they refer to a
    7·1 answer
  • What is the function of tRNA?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!