Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
s a melting temperature (tm) of 59 8C. If an RNA duplex oligonucleotide of identical sequence (sub-stituting U for T) is constructed, will its melting temperature be higher or lower?
RNA is a double stranded RNA with two complementary sequences
Duplex DNA is simply double stranded DNA
It is known A=U base pairs of duplex RNA is less stable than that of A=T base pairs of duplex DNA
RNA duplexes are considered to be more stable than DNA duplexes of comparable sequences but physical basis for thermal stability is not much known hence melting temperature of RNA duplex will be higher
B. Healthier ecosystems. If you're talking about benefits, this is the only positive on this list. The others are listing the difficulties or downsides.
