1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vova2212 [387]
3 years ago
15

Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha

s a melting temperature (tm) of 59 8C. If an RNA duplex oligonucleotide of identical sequence (sub-stituting U for T) is constructed, will its melting temperature be higher or lower?
Biology
1 answer:
erica [24]3 years ago
5 0

Melting temperature of RNA duplex will be higher

Explanation:

  • RNA is a double stranded RNA with two complementary sequences
  • Duplex DNA is simply double stranded DNA
  • It is known A=U base pairs of duplex RNA is less stable than that of A=T base pairs of duplex DNA
  • RNA duplexes are considered to be more stable than DNA duplexes of comparable sequences but physical basis for thermal stability is not much known hence melting temperature of RNA duplex will be higher
You might be interested in
Which of the following lists the reactants (raw materials) needed for photosynthesis to occur? *
Evgen [1.6K]

Answer:

carbon dioxide and water

Explanation:

carbon dioxide and water are the raw materials needed to start the reaction. They are on the left side of the equation so that is how you know.  

5 0
3 years ago
Read 2 more answers
What is the name of the processes that change the genetic information into each new form?
dusya [7]

I think the answer is evolution.

7 0
3 years ago
What is Carrying capacity?
mariarad [96]

Answer: average popular size in a particular habitat. The species population size is limited by environmental factors like adequate food,shelter,water,and mates

Explanation:

8 0
3 years ago
In a study published in the journal Nature, scientists studied eight ponds in Florida: four that were populated by a species of
AlexFokin [52]

Answer: the rate of pollination of flower, in a field next to a pond with no fish, will DECREASE.

Explanation:

POLLINATION is defined as the process by which flowering plants, through the aid of external agents such as insects,wind, water and other animals, are able to transfer pollen grains from an anther to a receptive stigma. Insects are the most common pollinators. They visit flowers to obtain nectar and pollen as source of food. Flowers use various features, such as colour and scent, to attract and guide insects to the food source within them. In the process of reaching their source of food, insects bring about pollination.

From the study conducted by scientist in Florida, eight(8) ponds where subjected to the the study. The first four (4) ponds had species of fishes that fed on dragonflies and dragonfly larvae, hence the reason for a decrease in the population of the dragon flies in the area around it. While the remaining four (4) ponds had NO fish and the area around it is populated with dragonflies and dragonfly larvae. This is so because of the absence of fish.

It was then noted that the dragon lies fed of the insect pollinators such as the bees and butterflies. Since these dragonflies and its larvae are abundant in the field which is close to the pond with no fish, they will grossly depend on the insect pollinators as their source of food thereby decreasing the rate of pollination in the field next to the pond with no fish.

7 0
3 years ago
Give examples of how scientist use repeated trials and replication in conducting experiments.
Anastasy [175]
When testing a hypothesis, scientists use repeated trials and replication to make sure that they get the same answer each time, and that it isn't just a lucky guess the first time.  They need be sure that the answer to their hypothesis is 100% the same every time.
3 0
4 years ago
Read 2 more answers
Other questions:
  • What are the benefits, risks and ethical concerns about biotechnology?
    10·2 answers
  • How were American farmers in the 1940s impacted by new technology? a. They were able to increase their productivity due to the p
    12·1 answer
  • A response that occurs automatically and helps in protecting our body is called a(n) ___.
    13·1 answer
  • Three ways in which organisms use carbohydrates
    9·1 answer
  • A scientist discovers a new species of marine bacteria that do not require oxygen to survive. In fact, dissolved oxygen in the w
    13·2 answers
  • Name another career that combines science with another interest
    14·1 answer
  • What type of development do Sawfish have?
    9·1 answer
  • What word describes a membrane that only allows certain things through it?
    11·1 answer
  • 3. In what part of Australia are koalas found? What do they eat?
    14·2 answers
  • What type of disorder is sickle cell anemia
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!