1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vova2212 [387]
3 years ago
15

Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha

s a melting temperature (tm) of 59 8C. If an RNA duplex oligonucleotide of identical sequence (sub-stituting U for T) is constructed, will its melting temperature be higher or lower?
Biology
1 answer:
erica [24]3 years ago
5 0

Melting temperature of RNA duplex will be higher

Explanation:

  • RNA is a double stranded RNA with two complementary sequences
  • Duplex DNA is simply double stranded DNA
  • It is known A=U base pairs of duplex RNA is less stable than that of A=T base pairs of duplex DNA
  • RNA duplexes are considered to be more stable than DNA duplexes of comparable sequences but physical basis for thermal stability is not much known hence melting temperature of RNA duplex will be higher
You might be interested in
GENETICS VOCABULARY QUIZ
wariber [46]
1. The story is talking about the dogs fur color.
2. The alleles are BB, bb, and Bb
3. The BB or black fur is dominant
8 0
3 years ago
PLEASE HELP I NEED IT NOW!!! :(((
ValentinkaMS [17]
I think either A or B
3 0
3 years ago
Read 2 more answers
The Miller and Urey experiment (or Urey–Miller experiment) was an experiment that made organic compounds out of inorganic ones b
MaRussiya [10]

Answer:

The goal of the Miller-Urey experiment was to test the idea that through basic, natural chemical reactions, the complex molecules of life (in this case, amino acids) may have emerged on our young world. The experiment was a success in generating during the simulation amino acids , the building blocks of life.  

They were trying to prove that the formation of life was preceded by chemical evolution.

Explanation:             <u> MILLER-UREY EXPERIMENT </u>

    The Miller-Urey experiment (or Miller experiment) was a chemical experiment that simulated the conditions thought to be present on early Earth at the time (1952) and under those conditions tested the chemical origin of life. At that time, the experiment sponsored Alexander Oparin's and J. B. S. Haldane 's belief that putative conditions favored chemical reactions on the primitive Earth that synthesized more complex organic compounds from simpler inorganic precursors. It was conducted in 1952 by Stanley Miller, supervised at the University of Chicago by Harold Urey, and published the following year as the classic experiment investigating abiogenesis.

Water (H2O), methane ( CH4), ammonia ( NH3) and hydrogen ( H2) were utilized in the experiment. Within a sterile 5-liter glass flask linked to a 500 ml flask half-full of water, the chemicals were all sealed. To cause evaporation, the water in the smaller flask was heated and the water vapour was allowed to reach the larger flask. In order to simulate lightning in the water vapor and gaseous mixture, continuous electric sparks were shot between the electrodes and then the simulated atmosphere was cooled again so that the water condensed and trickled into a U-shaped trap at the bottom of the apparatus.

The solution gathered at the trap had turned pink after a day, and the solution was deep red and turbid after a week of continuous operation. The boiling flask was then removed and mercuric chloride was applied to avoid microbial contamination. By adding barium hydroxide and sulfuric acid, the reaction was discontinued and evaporated to eliminate impurities. Using paper chromatography, Miller detected five amino acids found in the solution: glycine, α-alanine and β-alanine were positively identified, while aspartic acid and α-aminobutyric acid (AABA) were less certain, due to the spots being faint.

Therefore, Miller's experiment was trying to prove the formation of diverse organic molecules from inorganic molecules.

4 0
3 years ago
All renewable resources are inexhaustible. True or False?
Studentka2010 [4]
False, they are inexhaustible. If we were to use the resource as much as possible, it would exhaust and not be able to be used again.
6 0
3 years ago
The concentration of cholesterol (C27H46O) in blood is approximately 5.0mM. How many grams of cholesterol are in 315mL of blood
ASHA 777 [7]

The weight of cholesterol is 0.6 g.

Here use the concept of molarity.

<h3>What is molarity?</h3>

The amount of a substance in a specific volume of solution is known as its molarity (M). The moles of a solute per liter of a solution is known as molarity.

Molarity = no. of moles/volume (in L)

<h3>Calculation:</h3>

Given,

Molarity, M = 5.0 mM = 5 × 10⁻³ M

Volume, V = 315 mL = 315 × 10⁻³ L

To calculate,

Weight of cholesterol =?

We know that,

Molecular mass of cholesterol, C₂₇H₄₆O = 386

No. of moles = weight/ molecular mass

The formula is modified as,

Molarity = weight of cholesterol/ (molecular mass) (Volume)

Put the values in the formula,

5 × 10⁻³ = weight of cholesterol/ (386) (315 × 10⁻³)

Weight of cholesterol = 5 × 10⁻³  (386) (315 × 10⁻³)

                                    = 0.6 g

Hence, the weight of cholesterol is 0.6 g.

Learn more about molarity here:

brainly.com/question/13386686

#SPJ4

8 0
1 year ago
Other questions:
  • Tapping the triceps brachii muscle tendon will result in reflexive elbow extension. this is an example of a ____________ reflex.
    6·1 answer
  • Each codon of a DNA molecule code is for a specific _
    13·1 answer
  • One of the neurotransmitters can become decreased in the area of the corpus striatum. This results in the manifestations of Park
    15·2 answers
  • Some autotrophic euglena species become ______ when light levels are low
    15·2 answers
  • Read each example and identify it with one of the mechanisms that influence gene pools. A zebra migrates to join a different her
    11·2 answers
  • How do carbohydrates fuel protein function
    10·1 answer
  • How are weather and climate different? (3 facts pls)
    14·2 answers
  • How is diffusion related to smelling the odor of a skunk far away?
    14·1 answer
  • Why is cellular respiration important?
    14·1 answer
  • Maria wanted to grow a fern in her backyard. Acting on a suggestion from a friend, she collected brown dots from the underside o
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!