Question

Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has a melting temperature (tm) of 59 8C. If an RNA duplex oligonucleotide of identical sequence (sub-stituting U for T) is constructed, will its melting temperature be higher or lower?

Answer 1

Melting temperature of RNA duplex will be higher

Explanation:

• RNA is a double stranded RNA with two complementary sequences
• Duplex DNA is simply double stranded DNA
• It is known A=U base pairs of duplex RNA is less stable than that of A=T base pairs of duplex DNA

• RNA duplexes are considered to be more stable than DNA duplexes of comparable sequences but physical basis for thermal stability is not much known hence melting temperature of RNA duplex will be higher