1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vova2212 [387]
3 years ago
15

Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha

s a melting temperature (tm) of 59 8C. If an RNA duplex oligonucleotide of identical sequence (sub-stituting U for T) is constructed, will its melting temperature be higher or lower?
Biology
1 answer:
erica [24]3 years ago
5 0

Melting temperature of RNA duplex will be higher

Explanation:

  • RNA is a double stranded RNA with two complementary sequences
  • Duplex DNA is simply double stranded DNA
  • It is known A=U base pairs of duplex RNA is less stable than that of A=T base pairs of duplex DNA
  • RNA duplexes are considered to be more stable than DNA duplexes of comparable sequences but physical basis for thermal stability is not much known hence melting temperature of RNA duplex will be higher
You might be interested in
Which of the following is most likely to cause increases in a predator population?
Ksivusya [100]
1. B A reduction in competition. 2. C. Respiratory system
4 0
3 years ago
PLS HELP, I WILL MARK BRAINLIEST I NEED HELP​
kirill [66]

Answer: 0%

Explanation: white eyes is rr and red eyes is RR and if it had Rr it would still be red.

So the boxes filled in are rr and RR and offspring are Rr Rr Rr Rr which means there is no chance of a female offspring with white eyes (I think)

6 0
3 years ago
The failure of the attempt to reintroduce clapper rails in California was an example of the _____.
Lemur [1.5K]

The correct answer is option D, difficulty of redesigning workable ecosystems

Reason -

The area that was redesigned into an ecosystem actually failed to attract the endangered species of clapper rails in California because of the following two reasons –

a) Failed attempt of restoration of Cord grass ( a tree which is a dominant tree in the nesting habitat of clapper rail) . Even if few such trees were there they could not grow to their full height and thus were incapable of providing adequate nesting cover

b) Due to the lack of predatory insect, some herbivore insect in the ecosystem attacked the green grasses thereby making the nesting inadequate.

7 0
3 years ago
Please select the word from the list that best fits the definition.
geniusboy [140]

Answer: parralax

Explanation:

I just did it

6 0
3 years ago
Read 2 more answers
If a child belonged to blood type o, he or she could not have been produced by which set of parents?
jekas [21]
D. type a mother and type b father because they don’t have blood type o from their parent
7 0
3 years ago
Other questions:
  • consider the following data. which would have to happen to make the population growth of cheetahs in 2013 equal to the populatio
    8·1 answer
  • The anatomy of the intrinsic conduction system causes contraction of the ventricles to begin at the apex and move superiorly. Wh
    6·1 answer
  • If an invasive species that competes with foxes enters the community shown
    7·2 answers
  • How does reusing, reducing and recycling conserve energy
    6·1 answer
  • Analyze how osmosis affects the size of the cell when placed in either an isotonic, hypotonic or hypertonic solution.
    15·1 answer
  • Hi guys good morning :) this is easy so if you could help me that would be awesome <33
    15·1 answer
  • What is the Atretochoana also know as?
    9·2 answers
  • The structure of proteins is related to their function. true or false
    11·1 answer
  • Where are electrons located?
    9·2 answers
  • Which of the following is an example of pseudoscience?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!