1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vova2212 [387]
3 years ago
15

Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha

s a melting temperature (tm) of 59 8C. If an RNA duplex oligonucleotide of identical sequence (sub-stituting U for T) is constructed, will its melting temperature be higher or lower?
Biology
1 answer:
erica [24]3 years ago
5 0

Melting temperature of RNA duplex will be higher

Explanation:

  • RNA is a double stranded RNA with two complementary sequences
  • Duplex DNA is simply double stranded DNA
  • It is known A=U base pairs of duplex RNA is less stable than that of A=T base pairs of duplex DNA
  • RNA duplexes are considered to be more stable than DNA duplexes of comparable sequences but physical basis for thermal stability is not much known hence melting temperature of RNA duplex will be higher
You might be interested in
In a relatively small iguana population the allelic frequency is tracked for three generations. Webbing is a recessive allele; n
kakasveta [241]

Answer:

This is an example of founder effect.

Explanation:

Founder effect may be illustrated as the loss of genetic variation in a novel small population originated from the original population. The concept was initially presented by Ernst Mayr. It can be seen that genetic diversity has got reduced in the population of iguana due to the result of the flood that has washed all the iguana without webbed feet into the sea.  

The new population has got inclined from the small iguana population. Thus, the iguana population is regarded as an illustration of the founder effect.  

5 0
3 years ago
Read 2 more answers
If you observed the sister chromatids separating during cell division, what phase of mitosis would you be observing?
Sidana [21]
This is the anaphase of mitosis. Anaphase is characterized by the separation of sister chromatids or "pulling away" of the sister chromatids from the metaphase plate to the opposite spindle poles. This is also the phase where chromosomes reach its maximum condensation meaning that the process of the reformation of the nucleus will be shorter and easier.
3 0
3 years ago
Where is RNA oxygenated?
Llana [10]

The correct answer to the question which is stated above is:<span>

</span>RNA has the oxygenated form of ribose sugar, while DNA has deoxygenated form of ribose sugar. 

<span>>The pentose, which is ribose, is </span>oxygenated<span> <span>in </span></span>RNA<span> <span>while in DNA it is deoxygenated</span></span>

4 0
3 years ago
Many farmers in less densely populated areas, such as amazonia, practice _______________, also known as shifting cultivation or
Norma-Jean [14]
Many farmers in less densely populated area, such as Amazonia, practice slash and burn agriculture, also known as shifting cultivation or swidden agriculture where an area is cleared and then burned for the vegetative remains to release nutrients back into the soil. Shifting cultivation is a system where a farmer uses a piece of land, only to abandon or alter the initial use a short time later. Advantages of shifting cultivation includes; enhance control of pest and disease, inorganic matter addition which provide nutrient to crop, an effective way of weed control
7 0
3 years ago
Define photosynthesis​
Gemiola [76]

Answer:Photosynthesis is a process of cooking food by green plants using oxygen, Carbon dioxide, sunlight, water and minerals.

I hope it helped U

stay safe stay happy

7 0
2 years ago
Read 2 more answers
Other questions:
  • Lactase is an enzyme that is produced in the lining of the intestines. This enzyme helps the body speed up the breakdown of carb
    14·2 answers
  • Some major secretory molecules of the prostate are:
    7·1 answer
  • Write its any one function.(a) Ear drum (b) stapes (c) cochlea
    13·2 answers
  • How did earthquakes contribute to the destruction of over seventy villages in Tibet? (site 1
    11·1 answer
  • Nearly all cells found in multicellular organisms have similar needs. as a result, most organisms have developed similar _______
    13·2 answers
  • A poison that breaks down capillary tight junctions, allowing blood proteins to leak into the interstitial fluid, will cause wha
    14·1 answer
  • How many species of coral is there in the united states
    10·1 answer
  • Where did most of the comets in the Kuiper belt come from?
    13·1 answer
  • What best describes the work of endocrinologist? specializing in the endocrine system performing lots of surgery educating patie
    6·1 answer
  • what would be the result of a cytosine base being substituted for a thymine base in a dna segment during dna replication? (1 poi
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!