1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vova2212 [387]
3 years ago
15

Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha

s a melting temperature (tm) of 59 8C. If an RNA duplex oligonucleotide of identical sequence (sub-stituting U for T) is constructed, will its melting temperature be higher or lower?
Biology
1 answer:
erica [24]3 years ago
5 0

Melting temperature of RNA duplex will be higher

Explanation:

  • RNA is a double stranded RNA with two complementary sequences
  • Duplex DNA is simply double stranded DNA
  • It is known A=U base pairs of duplex RNA is less stable than that of A=T base pairs of duplex DNA
  • RNA duplexes are considered to be more stable than DNA duplexes of comparable sequences but physical basis for thermal stability is not much known hence melting temperature of RNA duplex will be higher
You might be interested in
How do cells store energy
Zarrin [17]
Cells conduct cellular respiration to get 36 ATP molecules which contain the majority of the energy in a cell
6 0
4 years ago
According to the all-or-nothing principle, Select one: a. the amount of time a neuron must "rest" in between firing episodes is
Brilliant_brown [7]

Answer:

<em>The correct option is d) once the electrical impulse reaches a certain level of intensity (its threshold), it fires and moves all the way down the axon without losing any intensity.</em>

Explanation:

In the field of biology, the all-or-nothing law can be described as a principle which focuses on the strength with which a nerve or muscle fibre responds to a particular stimulus, this strength being independent of the strength of the stimulus. The functioning of the impulse is just like the trigger of a gun. The more the force of a stimulus, the more will be the intensity of the nerve impulse.

4 0
3 years ago
9. What energy level in a food web contains the most energy?
Keith_Richards [23]

Answer:

A. Producer

Explanation:

Good Luck!!!

4 0
3 years ago
Why we need to monitor and effectively manage earth's resources
stiv31 [10]
Because it's vital to the survival of all species, not just human, that we have resources such as food and water. Also that those resources be clean and healthy. We also need to manage resources such as oil to make sure there are fewer wars like the ones happening in the Middle East. If you need anything else just message me.
7 0
3 years ago
Read 2 more answers
_____ 1. What are all living things composed of?
damaskus [11]
1 is D
2 is C
3 is A
4 is B
5 is A
6 is D
7 is B
8 is C
9 is asexual reproduction
10 is sexual reproduction
6 0
3 years ago
Read 2 more answers
Other questions:
  • When does DNA replication occur in the cell and what is the result
    13·1 answer
  • Your lab group is presented with an unknown mollusk. Your task is to assign it to one of the major taxonomic classes. Which char
    12·1 answer
  • What evidence did Mendel find that supported his law of independent
    15·2 answers
  • What factors influence the input and output of carbon through Earth's spheres? The oceans on Earth act as carbon sinks.
    6·1 answer
  • Which of the following is not a component of the hepatic triad found at the edges of a liver lobule?
    8·1 answer
  • Question 8(Multiple Choice Worth 1 points) (01.02 LC)What should you do if you see lightning while you are outside exercising? H
    13·1 answer
  • Which of the following statements correctly describes cytokinesis?
    14·1 answer
  • Which of the following describes why phospholipids are better suited to forming the cell membrane than regular fats or steroids?
    15·1 answer
  • EXPERT HELP: DON'T GUESS
    11·1 answer
  • Newton solved the problem of what holds the solar system together. How did this change the view of the universe?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!