1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vova2212 [387]
2 years ago
15

Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha

s a melting temperature (tm) of 59 8C. If an RNA duplex oligonucleotide of identical sequence (sub-stituting U for T) is constructed, will its melting temperature be higher or lower?
Biology
1 answer:
erica [24]2 years ago
5 0

Melting temperature of RNA duplex will be higher

Explanation:

  • RNA is a double stranded RNA with two complementary sequences
  • Duplex DNA is simply double stranded DNA
  • It is known A=U base pairs of duplex RNA is less stable than that of A=T base pairs of duplex DNA
  • RNA duplexes are considered to be more stable than DNA duplexes of comparable sequences but physical basis for thermal stability is not much known hence melting temperature of RNA duplex will be higher
You might be interested in
Suppose that a dominant allele (P) codes for a polka-dot tail and a recessive allele (p) codes for a solid colored tail. In addi
Maru [420]
If two individual are heterozygous for both traits then there genotype will each look like this PpLl. To find the probability, you need to do a cross with both traits. Each parent has the possibility of giving the following combinations: PL, Pl, pL, pl.
 
                 PL        Pl         pL           pl
PL         PPLL     PPLl     PpLL        PpLl        
Pl          PPLl      PPll      PpLl          Ppll
pL         PpLL     PpLl      ppLL        ppLl
pl          PpLl      Ppll       ppLl          ppll

Polka dot tail/ long lashes: 9/16
Polka dot tail/ short lashes: 3/16
Solid Tail / long lashes: 3/16
solid tail/ short lashes 1/16

The answer is (C) 9:3:3:1 ratio with 9 polka dot tails and long eyelashes, 3 polka dot tails and short eyelashes, 3 solid tails and long eyelashes (there seems to be a typo in the question) and 1 short tail short eyelash
           

3 0
3 years ago
Select all the correct answers.<br> Which two statements are true for the leading strand in DNA?
Ghella [55]

Question: Which two statements are true for the leading strand in DNA?

It is synthesized toward the replication fork.

It is synthesized in the 3′ to 5′ direction.

It is synthesized away from the replication fork.

It is synthesized in the 5′ to 3′ direction.

Answer:

The two statements that are true for the leading strand in DNA are "it is synthesized toward the replication fork and it is synthesized in the 5′ to 3′ direction"

Explanation:

Leading strand in DNA is the strand of new DNA being synthesized in the same direction where the replication fork is moving. The movement of replication fork allows the access of template for the new DNA. The DNA synthesis is continuous in the leading strand. It is synthesized in the 5' to 3' as DNA synthesis always takes place in this direction. This is because dNTP ( deoxyribonucleoside triphosphate) provides free 3' OH group where new dNTP can be added by the enzyme DNA polymerase.

3 0
3 years ago
What is Anna’s DRN? What is the purpose of this number?
Keith_Richards [23]
DRN or data release number refers your unique 4 digit code on the FAFSA confirmation page and your student aid report
4 0
2 years ago
This is an involuntary, non-striated muscle found throughout the human body.​
astraxan [27]

Answer: Smooth muscle

Explanation:

I got it wrong on usatestprep and when it showed me the answer key, smooth muscle was the correct answer.

8 0
2 years ago
?Which word in the sentence is the predicate nominative? A killer whale is a mammal with a black body and white patches. A. mamm
Lera25 [3.4K]
The answer is A, 'a mammal' because it goes with the copulative verb 'to be', i. e., 'is'.
8 0
3 years ago
Other questions:
  • Amar is making a cladogram. Out of all the species he is using, he knows that species X and Y are the least primitive and are th
    10·1 answer
  • Five examples of cells in plants and animals​
    6·2 answers
  • Why do the cells in all living things need energy
    9·2 answers
  • Which describes the greenhouse effect
    11·2 answers
  • Would we be able to move if we do not have a skeletal system
    10·1 answer
  • 4) All the offspring of a cross between a black-eyed Mendelian and an orange-eyed Mendelian have black eyes. What is the expecte
    12·1 answer
  • True / false A selectively permeable membrane allows all molecules to cross.
    10·2 answers
  • What is the relationship between carbon dioxide and oxygen for the otter
    11·1 answer
  • Which of these is the best definition of sustainable development?
    7·2 answers
  • Can someone help me plz n ty
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!