1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vova2212 [387]
3 years ago
15

Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha

s a melting temperature (tm) of 59 8C. If an RNA duplex oligonucleotide of identical sequence (sub-stituting U for T) is constructed, will its melting temperature be higher or lower?
Biology
1 answer:
erica [24]3 years ago
5 0

Melting temperature of RNA duplex will be higher

Explanation:

  • RNA is a double stranded RNA with two complementary sequences
  • Duplex DNA is simply double stranded DNA
  • It is known A=U base pairs of duplex RNA is less stable than that of A=T base pairs of duplex DNA
  • RNA duplexes are considered to be more stable than DNA duplexes of comparable sequences but physical basis for thermal stability is not much known hence melting temperature of RNA duplex will be higher
You might be interested in
For 20 Points.
frez [133]
The answer to your question is a
6 0
3 years ago
Read 2 more answers
One of the best ways to break the chain of infection is to use disinfectant agents when cleaning your house. wash your hands fre
wolverine [178]
Simple handwashing is more than enough to stop the spread of infectious diseases. The hands play a major role in spreading pathogens because it can come into contact with infected surfaces. Make sure to wash your hands especially when they get soiled or before you eat or drink.
4 0
3 years ago
The process of cellular respiration can be represented by the chemical formula
Mandarinka [93]

Answer:

A

Explanation:

The correct formula for cellular respiration is: 

Glucose (sugar) + Oxygen → Carbon dioxide + Water + Energy (as ATP).

7 0
3 years ago
Basic Genetics Practice Problems
Drupady [299]

Answer:

E

F

A

B

C

D

matched according to your questions.

5 0
3 years ago
How can the random distribution of alleles result in a predictable ratio?
levacccp [35]
Phenotypically and genotypically there are only two different ratios. If you think of a Punett square... 

<span>You could say that a pea plant with the trait for the dominant color green (G) could also carry the recessive trait for yellow (g). So let's say you mate a dominant green, (Gg) with another dominant green, (Gg). You would get 1 (GG), 2 (Gg) and 2 (gg). </span>

<span>Phenotypically (as in physical traitwise), the ratio is 3:1 because you have 3 green colored peas and one yellow. </span>

<span>Genotypically (as in traitwise), the ratio is 1:2:1, because you have 1 (GG), 2 (Gg) and 1 (gg). </span>

<span>So although it's random, for any specific trait there are only 4 different outcomes.</span>
4 0
3 years ago
Other questions:
  • For which one of the following observations were both Lamarck's hypothesis and Darwin's hypothesis in complete agreement? a. Acq
    11·2 answers
  • I will give brainliest to best answer!
    15·1 answer
  • Can someone in biology help me please !!!!!
    12·1 answer
  • In chemiosmotic phosphorylation, what is the most direct source of energy that is used to convert adp + pi to atp?
    5·1 answer
  • Sediment spreads horizontality and it goes from youngest on top to oldest on bottom. When sediment deposits in water, it also sp
    5·2 answers
  • The tundra only gets 10 inches of precipitation each year, on average. This is similar to which other biome? A- Desert B- Taiga
    9·1 answer
  • How is DNA used as evidence for evolution?
    14·1 answer
  • Which animals are the oldest vertebrate fossils?
    9·1 answer
  • What type of organism is a primary consumer?
    14·2 answers
  • 15 POINTS!!
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!