1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vikki [24]
3 years ago
14

Smog complex is: an atmospheric condition during which a warm layer of air stalls above a cool layer the precipitation of acidic

compounds formed when components of air pollution interact with other components in the air dust, soot, and other finely divided solid and liquid particles a condition associated with smog that causes eye irritation, irritation of the respiratory tract, and chest pains a mixture of pollutants, principally ground-level ozone
Biology
1 answer:
Eduardwww [97]3 years ago
5 0
A condition associated with smog that causes eye irritation, irritation of the respiratory tract, and chest pains.

Hope this helps!

-Payshence xoxo
You might be interested in
Orcas, or killer whales, are natural predators of sea otters. It has been observed that in regions where the sea otters are not
stellarik [79]

Answer:

C

Explanation:

Keystone species is the sea otter. Sea otters, playing a critical role in containing the urchin populations, prey on urchins and thus control the numbers of kelp grazers to maintain the forest.

Remember, keystone species is most often a top level predator in an ecosystem.

3 0
3 years ago
Is the sequence of a dna strand is AAGCCA what are the bases on its complementary strand
iragen [17]
TTCGGT! Hope this helped
4 0
3 years ago
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
3 years ago
On June 21 are there more hours of daylight in sanfrancisco or at the equator
pav-90 [236]
There would be more hours of sunlight at the equator
4 0
3 years ago
Which statement best explains how hereditary information is passed from parents to offspring
Maslowich

Answer:

.

Explanation:

8 0
2 years ago
Other questions:
  • Under which domain are plants classified? archaea bacteria eukarya plantae
    13·1 answer
  • Where can we find physical evidence to support the theory of evolution?
    7·1 answer
  • According to the phylogenetic tree, which phylum of organisms are most closely related to chordates?
    10·1 answer
  • ) The stem of a plant is growing upward while the roots grow downward. Which of these stimuli correctly describes the response o
    12·1 answer
  • 1. Which statement is true about renewable natural resources?
    13·1 answer
  • HHEEELPP[pppppp MMEEEEEE ill mark you brainiest !
    6·1 answer
  • Does anyone know what cells are in the respiratory system
    5·1 answer
  • What do mitochondria and chloroplasts have in common
    7·1 answer
  • Imagine you accidentally knocked a vase off a table and onto the floor. Describe the forces that would act on the vase before an
    14·1 answer
  • Replacement therapies for which two hormones were tested in this experiment? fsh and calcitonin estrogen and calcitonin fsh and
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!