1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nata [24]
3 years ago
12

An individual whose genotype is homozygous for the dominant allele is which of the following

Biology
1 answer:
Lapatulllka [165]3 years ago
3 0

Answer:

examples include, "FF" or "DD", or just two uppercase letters.

Explanation:

You might be interested in
What is the function of a transport protein
joja [24]
Each transport protein is designed to transport a specific substance as needed. Some channel proteins, for example, open only when they receive the correct signal, allowing the substances they transport to flow on demand.
4 0
4 years ago
AUUUAACUGUUCUGUCUAGAG
Lana71 [14]

Answer: three sets: ile. leu,phe,cys,leu,glu. glu,ile,cys,leu,val,asp,leu

The most likely sequence to be included is the R to L read, because of the STOP codon if read L to R. The lone ile would be the last amino acid of a different polypeptide, and there is no promoter sequence after the STOP codon.

Explanation:

auu,uaa,cug,uuc,ugu,cua,gag

Ile,STOP,leu,phe,cys,leu,glu

glu,ile,cys,leu,val,asp,leu (reverse)

After a STOP codon, a DNA promoter is required

5 0
3 years ago
Uau and uac both code for tyrosine. a change from uau to uac would thus be a _______ mutation; a change from uau to uag would be
Anton [14]
Thus be a SILENT mutation;
would be a NONSENSE mutation.
<span>ʕ•ᴥ•ʔ</span>
6 0
3 years ago
What protects against erosion? Explain. Why is grass good for erosion control?
Ivan

u can use con doms to stop it.

5 0
3 years ago
A student is collecting the gas produced
marissa [1.9K]

Answer:

0.062 moles of hydrogen gas

Explanation:

We must first out down the reaction equation before we can attempt to solve the problem.

Mg(s) + 2HCl(aq) ----> MgCl2(aq) + H2(g)

Next we obtain the number of moles in 1.5 g of magnesium metal from;

Molar mass of magnesium = 24.3 gmol-1

Number of moles of magnesium= mass/molar mass = 1.5g/24.3gmol-1 = 0.062 moles

From the reaction equation;

1 mole of magnesium metal yields 1 mole of hydrogen gas

0.062 moles of magnesium metal will yield 0.062 moles of hydrogen gas

Therefore, reaction of 1.5g of magnesium metal with excess hydrochloric acid will yield 0.062 moles of hydrogen gas.

7 0
3 years ago
Other questions:
  • How does genetic modification variation differ from genetic sexual reprodution variations
    12·1 answer
  • How many bacterial restriction enzymes are there available to scientists?
    11·1 answer
  • An animal that eats the dead remains and wastes of other animals and plants.
    14·2 answers
  • Transfer RNA (tRNA) is a ribonucleic acid about 50-60 nucleotides long. When a tRNA gets "charged" by covalent addition of its c
    5·1 answer
  • What sugar-based structure is used for adhesion to tissue?
    13·1 answer
  • Why are groups like NFA and FFA Important
    6·1 answer
  • LABEL THE DIAGRAM OF THE LEAF
    15·1 answer
  • What do you think the seed need to make it start to grow​
    9·2 answers
  • N your own words, describe why animals are eukaryotic organisms, and why we say their cells are advanced and
    14·2 answers
  • During one year, the birthrate in a country is 28 births per 1000 people, and the death rate is six deaths per 1000 people. What
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!