Describe at least one function for each type of biological macromolecule?

2 answers:

8 0

Carbohydrates provide structural support, in the form of cellulose in cell walls, for plants in addition to providing energy for the organism
Proteins are essential for muscle tissue's growth and development as well as, in the form of hormones and hormonal regulation, maintaining an organism's homeostasis.
Lipids make up the bilayer of cell membranes, and also aid hormonal signaling.
Nucleic acids store genetic information, and allow for ribosomal protein synthesis.

son4ous [18]3 years ago

8 0

Answer:

C,D

Explanation:

C: Proteins play a role in transport, enable movement, provide structure and support, and help make chemical reactions happen.

D: Nucleic acids carry genetic information, determine the structure of proteins, and help build proteins.

You might be interested in

Fossils of Glossopteris, an extinct fern, were discovered on which continents to support the theory of continental drift? Check

Alenkasestr [34]

Accordin to Du Toit's list supporting the theory of continental drift, the correct options are A, C, ad D. Fossils of Glossopteris were discovered on Africa, Australia, and Antarctica.

--------------------------------

Before answering the question, let us first review some theoretical frameworks,

• The tectonic plates theory explains the movement of the different plates based on the crust movements.

• The continental drift theory explains how these movements have been taking place for millions of years.

Alfred Wegener was the first one to state the concept of continental drift.

He proposed that once all continents were together a single big continent named Pangea, and with time, they split and separated into many pieces.

The geologist Du Toit published in 1937 a list of 10 pieces of evidence that would support the theory of tectonic plates and continental drift.

Du Toit's list includes evidence of Gondwana glaciation, lithological and structural evidence, plates fitting together, and paleontological evidence.

Paleontological evidence

• Plant and animal fossils distribution suggests the existence of a big unique continent. When reconstructing the supercontinent, the areas where these fossils were found get together in the same supercontinental region.

• Glossopteris (fern) impressions are widely distributed in determined areas of Africa, South America, India, Australia and Antarctica.

• Terrestrial vertebrate fossils also support the theory. The presence of Triassic tetrapods in all continents suggests terrestrial corridors between landmasses.

Finding Glossopteris in Australia, India, South America, Antarctica and Africa suggests that continents were once together, and these species used to live in the same region.

With time, these continents diverged and got separated by the oceans. The region where Glossopteris used to live got divided.

The correct options are A, C, and D. Africa, Australia, Antarctica.

----------------------------------

You can learn more about Glossopteris at

brainly.com/question/984155

7 0

2 years ago

A certain segment of DNA can be used as a molecular clock. Its rate of mutation is one mutation per 20 million years. Examine th

IgorC [24]

Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.

Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT

These species differ in 4 nucleotides.
This number should be multiplied by the rate of mutations

5 0

2 years ago

A couple believe they have brought home the wrong baby from the hospital. The wife has brown eyes and blood type A; her husband

Kay [80]

The baby is adopted by them because if it was born by the mother then the baby would have the same blood type A

7 0

2 years ago

some of the bacteria in the human gut do not survive well outside that environment, and produce vitamin k among other nutrients.

pishuonlain [190]

Commensalism :)
in case when bacteria and human, both are benifited.

5 0

3 years ago