The use of language and imagery that Edwin Arlington Robinson uses in his poem "Aunt Imogen" helps to create and shape the tone of the poem and add a deeper meaning. One example of imagery would be " That looked across the fields; and Imogen / Gazed out with a girl’s gladness in her eyes, / Happy to know that she was back once more / Where there were those who knew her, and at last / Had gloriously got away again." The language and descriptions that Robinson gives of this particular moment create a sense of wonder and happiness. It shows Aunt Imogen as being joyful and content, enjoying the view from the window and having fun. The language he uses also eludes to a beautiful view, giving the audience a sense of what it must be like to look out of that window. Robinson as uses imagery and language to show some of the more serious aspects of the poem, such as Aunt Imogen's internal struggles. " There was the feminine paradox—that she / Who had so little sunshine for herself / Should have so much for others. How it was / That she could make, and feel for making it, / So much of joy for them, and all along / Be covering, like a scar, and while she smiled" This description shows that Aunt Imogen is more than just a simple woman and that she has struggles of her own. This description changes the way that the audience and readers view the character of Aunt Imogen.
Answer:
By applying Chargaff's rule, which states that A only bonds with T and C only bonds with G in a DNA strand. One other factor that makes the rule true is because of the presence of hydrogen. Hydrogen ensure the bonding between the bases which holds the DNA Strands together.
Explanation:
By Applying Complementary Base-Pairing Rules, Let's say you have a DNA sequence of a specific gene on one strand of DNA. You can then use complementary base pairing rules to figure out the other DNA strand that makes up the DNA molecule. For example, let's say you have the following sequence:
AAGGGGTGACTCTAGTTTAATATA
You know that A and T are complements of each other and C and G are complements of each other. That means the DNA strand that pairs with the one above is:
TTCCCCACTGAGATCAAATTATAT
Use the rule and example and fill in the table.
This sounds like a type of social anxiety to me. I’m not a creative person but You could write about someone wanting to make friends with someone they see sitting along at lunch but they’re too shy to do it and they end up feeling guilty about it??? You can write about someone wanting to go out for a school play and because they’re too shy they don’t but they later feel guilty that they didn’t?? I have social anxiety so I feel guilty about being shy, if that helps at all.