1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
frozen [14]
4 years ago
12

Can someone help me with this question, its about frogs.

Biology
1 answer:
klio [65]4 years ago
6 0
The answer is a) glottis.
You might be interested in
The Two Main Processes By Which Plant Cells Absorb Release And Use Energy
noname [10]

photosynthesis and respiration

8 0
4 years ago
Read 2 more answers
Bacteria and viruses can multiply on living and nonliving surfaces. question 71 options:
Bad White [126]
Both because they have to have a host to feed on
5 0
3 years ago
Use the drop-down menus to identify the correct stage of the Calvin cycle based on the descriptions given below. In this stage,
masya89 [10]
It's the last option (Regeneration).
3 0
3 years ago
Read 2 more answers
John is Making a chocolate mousse cake. The recipe calls for 2 cups of chocolate, 1 stick of butter, and 5 eggs. John decides to
Eva8 [605]

Answer:

C. Substitution

Explanation:

Substitution is your answer because -

  • Substitution means switching or taking something else instead of something which can serve the purpose.
  • According to the meaning of Substitution, we can see that in the question it says that he INSTEAD used Margarine, and that means that he used something else instead of something which CAN serve the purpose.

And those were the reasons why that's your answer!

Learn more:

brainly.com/question/26555025

Social studies

brainly.com/question/26539371

Mathematics

brainly.com/question/26537282

Divisibility - Math

brainly.com/question/26525264

Mathematics

Thank You!

Answered by: ms115

#learnwithbrainly

4 0
2 years ago
Read 2 more answers
An experiment is designed to examine the causes of colon cancer. All rates housed in cages maintained at 25oC, with 16 hrs of li
weeeeeb [17]
I think its c because both groups receive the same amount of of sunlight
8 0
3 years ago
Other questions:
  • Organisms that live on land rarely compete for a.food B.space c.water b.oxygen
    7·2 answers
  • One disadvantage that longer, more colorful tails have for peacocks.
    7·1 answer
  • What is the name of lower Invertebrates that have a jelly-like layer between endoderm and ectoderm? A.Coelomates /B. Pseudoceolo
    6·2 answers
  • The following diagram shows the branching tree diagram for some animals.
    11·2 answers
  • Which of these animals would most likely be found in a tundra biome
    11·1 answer
  • What happens to the gas that enters the blood?
    13·2 answers
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • Where can the element iron be found in nature?
    12·1 answer
  • I neeeeedddddddd helpppppppp
    11·1 answer
  • Natural selection may affect allele frequency in populations due to the fundamental forces of evolution except which of the
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!