1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sesenic [268]
3 years ago
13

Does prokaryotes consist of chromosomes?

Biology
1 answer:
Levart [38]3 years ago
7 0
Well Prokaryotes usually consist of only one chromosone. 
You might be interested in
Which of the following statments is true about all cells?
oksano4ka [1.4K]

Answer: C

Explanation: Cells reproduce and divide through a process called mitosis

3 0
3 years ago
Please help!!! <br> What are things that tend to gain electrons and become negative
mafiozo [28]

Explanation:

This electron exchange results in an electrostatic attraction between the two atoms called an ionic bond. An atom that loses one or more valence electrons to become a positively charged ion is known as a cation, while an atom that gains electrons and becomes negatively charged is known as an anion.

3 0
3 years ago
sequence 1 has a blank muation original: ATCGCCGGAATAGGCATCAGCAGT SEQUENCE 1: ATCGCCCGAATAGGCATCAGGAGT
Nonamiya [84]

Answer:

interesting

Explanation:

I love this, good job. Have a great day :))

4 0
3 years ago
How can scientists determine the relative age of the fossil?
Strike441 [17]

Answer:

Radiometric dating methods

Explanation:

Geologists usually use radiometric dating methods, based on the natural radioactive decay of certain elements such as potassium and carbon to find the age of fossils.

7 0
2 years ago
Explain how osmosis creates turgor pressure in plants
astraxan [27]
Osmosis refers to the transfer of water across a membrane and pressure of water inside plant cells is called turgor pressure. Osmosis causes cells to lose or gain water, which means it can increase or decrease the turgor pressure inside the cells. When the concentration of water available outside the cell is higher than inside, plant cell will gain water. When it's the other way around, the plant cells lose water.
6 0
3 years ago
Other questions:
  • A gene encodes a protein of 350 amino acids. a mutation creates an allele that only has the first 120 amino acids. what could ha
    9·1 answer
  • The shrubs and trees in windbreaks protect soil from erosion by rain water. <br> true or false
    13·1 answer
  • 1.) what is a polar molecule?<br> 2.) why is water a polar molecule? Explain
    12·1 answer
  • Which of the following is NOT likely to cause increased rates of mutation in an organism
    15·2 answers
  • A client reports muscle cramps in the calves and feeling "tired a lot." the client is taking ethacrynic acid (edecrin) for hypot
    14·2 answers
  • _______________, which causes abdominal pain and diarrhea, multiplies rapidly in prepared foods (
    10·1 answer
  • Which choice would most likely reduce the amount of energy resources a person uses
    13·1 answer
  • Answer the question above
    11·1 answer
  • What is something your body does that keeps it from extreme changes?
    10·1 answer
  • The movement of sperm from the seminiferous tubules to the epididymis is the result of?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!