Ask question

Ask question

All categories

denis-greek [22]

3 years ago

11

What Australian timber made the London docks?

2 answers:

barxatty [35]3 years ago

8 0

Turpentine; Syncarpia glomulifera

valkas [14]3 years ago

7 0

Do you have any options for this question? You could just research the London docks to help find your answer!

You might be interested in

what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC

VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0

2 years ago

Examine the following diagrams. Columns I and II contain rock layers A, B, C, D, E and F. Both columns were taken from the same

irga5000 [103]

The Answer is C) C & D

8 0

2 years ago

Matching (1pt each) Match the structures/organisms on the right to the appropriate statement below. Use each letter once.

kipiarov [429]

Answer:

i

Explanation:

3 0

2 years ago

Using the human species as an example, explain why physical appearance or morphology is not always useful for identifying organi

rusak2 [61]

Answer:

Get sns

Explanation:ncnc

3 0

2 years ago

Is an adaptation on one organism necessarily useful on another? Explain with examples.

Pani-rosa [81]

Answer:

Do you mean one organisms offspring or same species?

5 0

3 years ago