1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
WITCHER [35]
3 years ago
7

The use of _____ during pregnancy is most associated with premature birth, low birth-weight infants, and fetal death. nicotine c

affeine aspirin all of these options
Biology
2 answers:
ser-zykov [4K]3 years ago
8 0

The use of nicotine during pregnancy is most associated with premature birth, low birth-weight infants, and fetal death

Further Explanation:

Smoking during the gestation period increases the risk of health-related problems for the developing fetus. They include low birth weight, and preterm birth, birth defects of the mouth and lip. Smoking during and after pregnancy also increases the risk of sudden infant death syndrome (SIDS)

Injurious effects of drugs are:

  • To affect the memory of the brain
  • To affect growth.
  • To birth defect.
  • To cause behaviour and learning problems.
  • Hallucination

Nicotine drug communicates with endogenous acetylcholine receptors in lung and brain. The exposure of nicotine during developmental stage of fetus obstructs the normal neurotransmitter function. Thus, development of neurodevelopment abnormalities can affect the timing of neurotrophic actions.

During pregnancy, mothers should avoid having nicotine or smoking because the liver of the fetus is under development and not capable to process any kind of drug. If a woman is conceiving then she should care regarding drugs because it definitely affects the growth of the child.

Learn more:

  1. Learn more about the effects of alcohol on brain<u>brainly.com/question/2034996 </u>
  2. Learn more about alcohol is an antidepressant drug<u>brainly.com/question/4541397 </u>
  3. Learn more about the effect of alcohol on body weight<u>brainly.com/question/826810 </u>

Answer Details:

Grade: High School  

Subject: Health

Topic: Side effects of nicotine

Keywords

Alcohol, child, growth, nicotine, drug, behavior, learning, brain, memory, pregnancy, mother, disorder, fetus, learning.

rusak2 [61]3 years ago
4 0

The drug that is associated when having to intake it when pregnant that is likely causing premature birth, low birth weight infants and the fetal death is the use of nicotine. This type of drug is a form of agonist in regards with nicotinic acetylcholone receptors.

You might be interested in
What form of natural selection is acting on beak length in soapberry bug populations feeding on the different fruits?soapberry b
Lilit [14]
Bugs with shorter bills had more access to sustenance, enabling them to deliver all the more posterity. Bugs that happened to have short breaks were better ready to feast upon the little organic products. Their expanded access to nourishment enabled them to deliver all the more posterity, which likewise had little snouts. In any case, bugs with little bills did not emerge so as to feast upon the little natural products. Transformative change comes to fruition as the extent of people in the populace showing a specific characteristic increments from age to age. The characteristic does not change step by step in all individuals from the populace.
4 0
3 years ago
In which of the following cells would the cycle be shortest for adult cell, teenager kidney,embryonic cell, unfertilised egg cel
Lapatulllka [165]
Unfertilised egg cell
6 0
3 years ago
A guiding question instead of a hypothesis is most likely used in which of the following?
klemol [59]
The answer is

D. Repeated trials

97% Verified!

Hope This Helps!:)
8 0
3 years ago
The frequency of alleles in a population that is in hardy Weinberg equilibrium?
maksim [4K]

The answer would be D.

HWE states that genotype and allele frequencies in a population remain constant from generation to generation when evolutionary influences are absent(such as gene flow or natural selection).

7 0
4 years ago
As we know three most common house hold fuse value sare 3A,5A and 13A.
Reptile [31]

The list of household electrical appliances categorized according to their power consumption and what fuse they will use are:

<u>3A Fuse </u>

  • A table lamp,
  • Computer
  • Blender,
  • Refrigerator  
  • Deep freezer etc.

For every appliance that is rated between 700 and 3000 watts, it's plug should have a 13-amp fuse installed onto it.

<h3>What is a fuse value?</h3>

A fuse rating is the amount of current required to blow (break) the fuse. When a fuse blows, it disconnects power from an electrical system.

The fuse rating is generally printed on the fuse itself. The fuse rating is often expressed in 'amps,' which is the standard measurement for electrical current.

<h3>Why are electrical fuses important?</h3>

If an appliance malfunction results in an excessive current flow, the fuse shuts off the circuit.

If something goes wrong, this safeguards both the wiring and the appliance. A wire that melts easily is within the fuse.

Learn more about fuse values at;

brainly.com/question/23959921

#SPJ1

Full Question:

As we know that the three most common household fuse values are 3A, 5A, and 13A.

Make a list of your household electrical appliances. Divide them into three groups according to their power consumption to decide what fuse should be fitted in the plug for each of them.

6 0
2 years ago
Other questions:
  • Why is bone tissue classified as connective tissue?
    5·1 answer
  • What was the possible function of the horns of the dinocephalian, and was this animal a herbivore or carnivore? question 4 optio
    7·1 answer
  • What type of protein speeds up the rate of a chemical reaction in a living thing?
    10·1 answer
  • Identify the placement of items A-F using the drop-
    9·2 answers
  • Which of these helps explain water having a heat specific heat
    6·1 answer
  • Many different factors can cause low crop yield. Which factor listed is a biotic factor?
    12·1 answer
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • Determine if the karyotype is male or female
    15·1 answer
  • NEED HELP ASAP PLS THANK YOU
    13·1 answer
  • Which diagram shows the objects arranged so that a new moon would be visible from Earth?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!