Answer:
For the first one, I think new species are created through "Natural Selection"
During transcription, a fragment of DNA is used as template to synthesize a complementary mRNA molecule. Subsequently, this mRNA is in turn used as a template to synthesize a protein by a process called translation.
In this case, the complementary mRNA sequence is:
- 3´GAGAGGGGGCGCCCCCGACAUGAUAGUACGCAGCAGAGCCAAUUAAA 5´
- Transcription is a molecular mechanism by which a fragment of DNA (e.g., a gene) is used as a template to synthesize a complementary RNA sequence, usually a messenger RNA (mRNA) sequence.
- Subsequently, this mRNA sequence is then used as a template to produce a polypeptide chain in the ribosomes by a process called translation.
- According to the base complementarity rules, Adenine always pairs with Thymine, whereas Guanine always pairs with Cytosine.
- In RNA, Thymine (T) bases are replaced by Uracil (U).
Learn more in:
brainly.com/question/837295?referrer=searchResults
The answer is B. They have become habituated to human contact.
The statement which correctly describes natural selection is (1) it favors the survival of certain members of the species and results in a change in the proportion of individuals with highly <span>adaptive traits.
Natural selection, by definition talks about the successful passing down of genes from older generations to younger generations. These then are better adapted to their environment. This is exactly what the first answer is about. </span>
Warm air raising toward the ceiling or attic of a house warm air is less dense than cool air.
Wind is an example of a convention current sunlight or reflected light radiates heat.
