1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aleksandrvk [35]
3 years ago
14

The bases of one of the strands of DNA in a region where DNA replication begins are shown here. What is the sequence of the prim

er that is synthesized complementary to the bases in bold? (Indicate the 5' and 3' ends of the sequence.) 5' AGGCCTCGAATTCGTATAGCTTTCAGAAA 3'
Biology
1 answer:
garik1379 [7]3 years ago
5 0

Answer:

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

Explanation:

The synthesized primer will have base pair complementary to the given strand and also the leading and lagging ends will be opposite to the given strand.

As per the base pair rule for DNA

Guanine binds to cytosine & vice versa

Adenine always binds to thymine & vice versa

Given Sequence -                5' AGGCCTCGAATTCGTATAGCTTTCAGAAA 3'

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

You might be interested in
As the human population increases l, which problems is technology least likely to be able to solve
LuckyWell [14K]

The correct answer would be: dependence on nonrenewable resources.

A nonrenewable resources are resources that cannot be readily replaced by natural means, such as fossil fuels (oil, natural gas). The use of these resources is not sustainable because their formation takes billions of years.  The whole world is dependent on these non-renewable sources but they are becoming more scarce daily.

5 0
3 years ago
Read 2 more answers
In 2008, scientists in France discovered that a virus was capable of infecting another virus. Which theory might be supported by
Salsk061 [2.6K]

Viruses (Biology)


In In 2008, scientists in France discovered that a virus was capable of infecting another virus. Which theory might be supported by this information?


Answer: A virus is living.


<span>I hope this helps, Regards.</span>

8 0
3 years ago
In John Watson's Little Albert experiment, the white rat was the ________ and the loud noise was the ________.
Korolek [52]

Answer:

In John Watson's Little Albert experiment, the white rat was stimulus associated specific entity and the loud noise was the associated stimulus.

7 0
3 years ago
Please help me please will give brainliest ​
Svet_ta [14]
Is this just a random question or is there any information given to us about his parents? if not, C would be your answer
7 0
2 years ago
Radioactive decay occurs when atoms:
arsen [322]

Answer:

I think it's A

Explanation:

4 0
3 years ago
Other questions:
  • All life depends on the availability of usable energy. this energy is released when ?
    13·1 answer
  • What is true about a meal of a piece of salmon with garlic butter? high in fiber, low in protein. No vitamin B12, no iron, low i
    14·2 answers
  • Which would prevent a plant from growing?
    10·2 answers
  • What does NADP stand for and what does it do?
    9·2 answers
  • URGENT!! WILL GIVE BRAINLIEST *IF IT IS CORRECT*
    8·2 answers
  • If the number of frogs decreases which population will most likely increase
    12·2 answers
  • When a object remain in the same place is called
    10·2 answers
  • A biologist is surveying the animal life found in the deciduous forests of the Adirondack Mountains in New York. He spots a moth
    12·1 answer
  • What molecules do plants take in for their energy needs<br><br>​
    9·2 answers
  • When is cell-to-cell communication particularly important in regulating gene expression?
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!