1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aleksandrvk [35]
3 years ago
14

The bases of one of the strands of DNA in a region where DNA replication begins are shown here. What is the sequence of the prim

er that is synthesized complementary to the bases in bold? (Indicate the 5' and 3' ends of the sequence.) 5' AGGCCTCGAATTCGTATAGCTTTCAGAAA 3'
Biology
1 answer:
garik1379 [7]3 years ago
5 0

Answer:

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

Explanation:

The synthesized primer will have base pair complementary to the given strand and also the leading and lagging ends will be opposite to the given strand.

As per the base pair rule for DNA

Guanine binds to cytosine & vice versa

Adenine always binds to thymine & vice versa

Given Sequence -                5' AGGCCTCGAATTCGTATAGCTTTCAGAAA 3'

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

You might be interested in
What is the best strategy for avoiding long term stress
blsea [12.9K]

You should always keep calm and try to think positive never put your self down never ever

8 0
3 years ago
Read 2 more answers
If brown eyes are dominant over blue eyes, which of the following genotypes would cause an individual to have brown eyes? bb Bb
kolezko [41]
Both b and c, BB being both homozygous for brown eyes, and Bb being heterozygous being B= brown / b= blue & since Brown eyes are dominate over blue eyes it would certainly have a much higher percentage (75%/100%) of having brown eyes rather than blue eyes
8 0
3 years ago
Read 2 more answers
Scientific root words
Firlakuza [10]

Hi there! I'd like to help but I need more information about your question.

4 0
3 years ago
Which of the following statements is true in humans?
gayaneshka [121]

Answer:

Im not sure ,lol

Explanation:

hhaahan

3 0
3 years ago
Describe two examples of steroids and their physiological function.
Musya8 [376]
Testosterone is a steroid. Its physiological functions are:

Determines the the gender of a developing embryo

Development of reproductive organs and the prostrate gland in males

Responsible for secondary sexual characteristics in males such as deeper pitch, increased muscle bulk, hair on the upper lip

Regulates normal sperm development

Another is cholesterol. Physiological functions are:

Helps maintain the structure of cells and vessels improving overall health and function in the body.

Percursor to important sex hormones such as testosterone and estrogen.

Used as an insulator around nerves and is absolutely essential for brain function.

Precursor to Vitamin D, which supports a healthy immune and nervous system
6 0
3 years ago
Other questions:
  • The four nitrogenous bases found in DNA are cytosine, thymine, adenine, and deoxyribose sugar.
    9·2 answers
  • Which of the following are characteristics of the talga?
    12·2 answers
  • Where are Salt Marshes found ?
    10·1 answer
  • The structure which eats breathes and excretes wastes for the developing baby throughout gestation
    11·1 answer
  • The spinal cord is a vital part of our body.explain​
    15·2 answers
  • Some lizard species contain females only, so there is no sexual reproduction. In these
    7·1 answer
  • My teacher wants me to make something that prevents pollution or could help us not have it. Any ideas that are easy to make? I d
    7·1 answer
  • Which of the samples shown below are eukaryotic?
    7·2 answers
  • Which resource is renewable? A water B coal C oil D natural gas
    15·2 answers
  • Indicater I need the meaning
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!