1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aleksandrvk [35]
3 years ago
14

The bases of one of the strands of DNA in a region where DNA replication begins are shown here. What is the sequence of the prim

er that is synthesized complementary to the bases in bold? (Indicate the 5' and 3' ends of the sequence.) 5' AGGCCTCGAATTCGTATAGCTTTCAGAAA 3'
Biology
1 answer:
garik1379 [7]3 years ago
5 0

Answer:

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

Explanation:

The synthesized primer will have base pair complementary to the given strand and also the leading and lagging ends will be opposite to the given strand.

As per the base pair rule for DNA

Guanine binds to cytosine & vice versa

Adenine always binds to thymine & vice versa

Given Sequence -                5' AGGCCTCGAATTCGTATAGCTTTCAGAAA 3'

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

You might be interested in
Neurons are brain cells. Where would a new neuron come from?
Paladinen [302]
Cells break into 2’s and keep breaking apart
5 0
3 years ago
Read 2 more answers
Which of the describes convection?
Maru [420]
The answer is B because convection is the transfer of heat without two objects touching.
8 0
3 years ago
Read 2 more answers
A few students want to live healthier lifestyles. They decide to use one of the
dalvyx [7]
The answer is sunflower oil
3 0
2 years ago
1. What happens to the cell membrane during endocytosis?
Yanka [14]

Answer:

The cell membrane will fold over a substance or particle until it becomes completely enclosed by the membrane

Explanation:

Endocytosis is when a substance or particle from the outside is captured and engulfed by the cell membrane until it is in the inside.

8 0
2 years ago
Can someone help me with this question
Alex_Xolod [135]

Answer:

A segment of DNA

6 0
3 years ago
Read 2 more answers
Other questions:
  • Which term is used to describe genes that are located physically close to each other on the same chromosome?
    14·1 answer
  • What is reason for meiosis
    8·2 answers
  • Explain how scientific discoveries in biotechnology have improved people's lives
    7·2 answers
  • Describe how elements joining together to form chemical compounds is similar to the way the letters on a computer keyboard join
    15·1 answer
  • What idea is Malthus known for?
    9·1 answer
  • What is a qualitative observation
    13·1 answer
  • What is the relationship between temperature and the dissolution of ocean water salts?
    9·2 answers
  • Which of the following statements about mitosis and meiosis is *NOT* true?
    12·2 answers
  • In pointers dogs, the Punnett square for tail length is below (gene A). Use the Punnett Square below to determine the possible o
    10·1 answer
  • Which type of carbohydrate is this?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!