1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aleksandrvk [35]
3 years ago
14

The bases of one of the strands of DNA in a region where DNA replication begins are shown here. What is the sequence of the prim

er that is synthesized complementary to the bases in bold? (Indicate the 5' and 3' ends of the sequence.) 5' AGGCCTCGAATTCGTATAGCTTTCAGAAA 3'
Biology
1 answer:
garik1379 [7]3 years ago
5 0

Answer:

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

Explanation:

The synthesized primer will have base pair complementary to the given strand and also the leading and lagging ends will be opposite to the given strand.

As per the base pair rule for DNA

Guanine binds to cytosine & vice versa

Adenine always binds to thymine & vice versa

Given Sequence -                5' AGGCCTCGAATTCGTATAGCTTTCAGAAA 3'

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

You might be interested in
What is the "goal" of an element in bonding chemically (what does it need to do to be stable"
Tresset [83]
Each atom wants to follow the octet rule and have eight electrons in the valence
7 0
3 years ago
8. Gestation period of cow is days,<br>(A) 283 - 285 (B) 290 - 292<br>(C) 142 - 145 (D) 152 - 154​
Agata [3.3K]

Answer: A. 283-285

Explanation:

7 0
3 years ago
Read 2 more answers
What will happen to a cell that does not have a cell wall if placed in a
Verdich [7]

What will happen to a cell that does not have a cell wall if placed in a (b swell and burst )
5 0
3 years ago
Read 2 more answers
If an organism has a diploid chromosome number of 24, what would the haploid number be?
inysia [295]
12
But what I got taught was that in a haploid cell there was 23 but that may be in a specific thing.
4 0
3 years ago
.. Which pair of organisms is most likely to have adaptations in common?
Juli2301 [7.4K]

Answer: the 1st one

Explanation:

8 0
3 years ago
Other questions:
  • Compare the two pictures above. These show the beginning of mitosis and meiosis. How are they different?
    10·2 answers
  • Which products are the most effective for killing e.coli
    8·1 answer
  • Long, snowy winters as well as evergreen trees such as pine and fir are found in ______.
    11·1 answer
  • Does blood go back to the lungs first before going back to the heart
    8·1 answer
  • What did the earliest vascular plants lack? a) fruits b) flowers c) roots d) all of the above
    10·1 answer
  • What are the two possible fates of heat energy that come from the sun?
    5·1 answer
  • Select all that apply.
    9·2 answers
  • Can you tell me the 15 errors in the code you just created?​
    6·2 answers
  • Material produced from living or recently living plants or animals and their metabolic byproduct is?
    9·1 answer
  • What is unique about the life cycle of angiosperm ?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!