1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aleksandrvk [35]
3 years ago
14

The bases of one of the strands of DNA in a region where DNA replication begins are shown here. What is the sequence of the prim

er that is synthesized complementary to the bases in bold? (Indicate the 5' and 3' ends of the sequence.) 5' AGGCCTCGAATTCGTATAGCTTTCAGAAA 3'
Biology
1 answer:
garik1379 [7]3 years ago
5 0

Answer:

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

Explanation:

The synthesized primer will have base pair complementary to the given strand and also the leading and lagging ends will be opposite to the given strand.

As per the base pair rule for DNA

Guanine binds to cytosine & vice versa

Adenine always binds to thymine & vice versa

Given Sequence -                5' AGGCCTCGAATTCGTATAGCTTTCAGAAA 3'

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

You might be interested in
Please help! Why do plants produce bubbles during photosynthesis? Why is counting them a good way to determine the rate of the p
arlik [135]

Answer:

Bubbles are nothing but the oxygen which arise around the green parts of the plant.

3 0
3 years ago
what is a mass extinction? what is a mass extinction? an event that causes the extinction of a large fraction of earth's species
sineoko [7]

A mass extinction event occurs when a species disappears far more quickly than it is replaced. This is typically understood as the loss of around 75% of all species over a "short" period of geological time, or fewer than 2.8 million years.

An enormous number of species were wiped out by a harsh, worldwide, swift, and selective event is mass extinction. According to marine fossils, at least 75% of all species are thought to have become extinct. The most recent mass extinction is the Cretaceous-Paleogene extinction event, which is also the only one that can be proven to have been caused by a significant asteroid impact. All non-avian dinosaur species, making up about 76 percent of all species on the earth, perished during mass extinction. The Chicxulub asteroid impact in what is now Mexico, which occurred 66 million years ago, caused an ecosystem collapse that resulted in the extinction of the dinosaurs and >75% of all land and sea species as well as the macroevolution of mammals.

Learn more about mass extinction

brainly.com/question/11872946

#SPJ4

8 0
1 year ago
It's hypothesized that cells formed spontaneously in the primordial soup, but without further changes could not :
Fantom [35]

i think the answer is either A or D but im strongly going to go with D

3 0
3 years ago
What is the main function of the cell membran
Orlov [11]
Controls what goes in and out of a cell
4 0
3 years ago
How long can sperm live outside of the body?
liraira [26]
About 20 minutes<span>Sperm can live outside of the body for only about 20 minutes to an hour, depending on how exposed the semen is to the air and other environmental factors. To avoid the slightest risk of pregnancy, a woman should make sure that ejaculated semen doesn't get at all close to her vagina.</span>
6 0
4 years ago
Other questions:
  • Some ribosomes are suspended in the cytosol of a cell, whereas other ribosomes _______.
    7·1 answer
  • Peanut butter and cottage cheese each provide which two sources?
    14·2 answers
  • Which feature is an example of behavioral adaptation? A. turtles’ shells B. nocturnal nature in rodents C. cacti’s ability to st
    10·2 answers
  • Which physical change takes place when an igneous rock turns into sedimentary rock?
    8·2 answers
  • What should the researcher add to the aquarium to help decrease the concentration of ammonia in the aquarium?
    15·1 answer
  • Please briefly share the influences on your decision to pursue the field of medicine, including shadowing experiences and other
    14·1 answer
  • ____________ are big groups of genes that sit in the middle of almost all your body’s cells. Chromosomes DNA Genetic mutations S
    8·2 answers
  • Which options are examples of innovations that increased the carrying capacity of Earth for people? THANKS!
    13·1 answer
  • The hypothesis becomes the basis of what?
    8·1 answer
  • What is the equation for a photosynthesis???????????????​
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!