1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aleksandrvk [35]
3 years ago
14

The bases of one of the strands of DNA in a region where DNA replication begins are shown here. What is the sequence of the prim

er that is synthesized complementary to the bases in bold? (Indicate the 5' and 3' ends of the sequence.) 5' AGGCCTCGAATTCGTATAGCTTTCAGAAA 3'
Biology
1 answer:
garik1379 [7]3 years ago
5 0

Answer:

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

Explanation:

The synthesized primer will have base pair complementary to the given strand and also the leading and lagging ends will be opposite to the given strand.

As per the base pair rule for DNA

Guanine binds to cytosine & vice versa

Adenine always binds to thymine & vice versa

Given Sequence -                5' AGGCCTCGAATTCGTATAGCTTTCAGAAA 3'

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

You might be interested in
What similarities can be found among the different types of wild goats?<br> EXPLAIN
vitfil [10]

The similarities that can be found among the different types of wild goats are:

  • They are large herbivores.
  • They are sources of energy for large predators.

<u>What are wild goats?</u>

Wild goats are species of goats that can be found among shrubs, mountains, and forests. They have been classified as a vulnerable species and this is because they serve as sources of energy for predators.

<u />

They are large herbivores that can be found mostly in rocky plateaus.

5 0
2 years ago
What three features of seabirds are specifically adaptive for life at sea
Ilya [14]
1.Beak for catching prey
2.Wings to fly away from danger
3. Ability to balance
7 0
3 years ago
Is this organelle more likely to be found in animal cells or plant cells
Anna007 [38]
More likely to be found in plant cells
7 0
3 years ago
Read 2 more answers
PLEASE HELP
zalisa [80]

Answer:

Producer: Deer, Ant's, Carrots, Chickens

Consumer: Dog, Bear,

Decomposer: Mushrooms, Acorns, Flowers, Grass,

Explanation:

5 0
3 years ago
Read 2 more answers
If a cell was a sugar factory​
Hitman42 [59]
Are you asking which cell is referred to as a sugar factory? That would be (in plant organisms) chloroplasts
6 0
3 years ago
Other questions:
  • Is the only metal that is not solid at room temperature.
    8·2 answers
  • The genetic makeup of any organism is its ________, which determines the physical characteristics called its ________. genotype;
    13·1 answer
  • Why roots need to use different methods to absorb water and ions?
    6·1 answer
  • The waste from plants and animals is collectively called _______
    12·2 answers
  • The "Father of Modern Taxonomy" is _____. Aristotle Linnaeus Theophrastos Cordus
    6·2 answers
  • During an intramuscular injection procedure, the medication label should be checked:
    13·1 answer
  • Which individual is most clearly in need of diagnostic testing for lung cancer?
    6·1 answer
  • Which of the following is an example of succession?
    7·1 answer
  • Which characteristics demonstrate that sea anemones are animals and not plants? Select two that apply.
    12·1 answer
  • When we ran the serum of a patient who seems to be severely ill with arthritis at the lowest dilution suggested by the latex agg
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!