1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aleksandrvk [35]
3 years ago
14

The bases of one of the strands of DNA in a region where DNA replication begins are shown here. What is the sequence of the prim

er that is synthesized complementary to the bases in bold? (Indicate the 5' and 3' ends of the sequence.) 5' AGGCCTCGAATTCGTATAGCTTTCAGAAA 3'
Biology
1 answer:
garik1379 [7]3 years ago
5 0

Answer:

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

Explanation:

The synthesized primer will have base pair complementary to the given strand and also the leading and lagging ends will be opposite to the given strand.

As per the base pair rule for DNA

Guanine binds to cytosine & vice versa

Adenine always binds to thymine & vice versa

Given Sequence -                5' AGGCCTCGAATTCGTATAGCTTTCAGAAA 3'

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

You might be interested in
Bacteria that is jagged and random is called what?
Burka [1]
It is called jagged gaphene i think
6 0
3 years ago
What is the Number of bonds formed in muscle
vovangra [49]

Answer:

there are three.

Explanation:

8 0
3 years ago
While observing slides under a microscope, jack adjusts the the microscopes mirror so that a circle of light can be seen. Which
Irina18 [472]
A compound microscope
8 0
3 years ago
Feedback mechanisms have evolved that maintain homeostasis. Describe how homeostasis is maintained through feedback. In your ans
Mrac [35]
Homeostasis is maintained through feedback because when one certain parameter of your body goes out of the homeostatic bounds, feedback mechanisms will message this back towards the regulatory mechanisms which are responsible for homeostasis maintenance in the first place. Another thing, other than death, which can happen would be a higher bodily temperature for example. 
3 0
3 years ago
Which stage represents the climax community
castortr0y [4]

Explanation:

climax community refers to a stable ecosystem in its final stage of ecological succession. Succession is when one community of plants and animals replaces another in an ecosystem. In a climax community, the plants and animals are in balance with each other and their environment.

8 0
2 years ago
Other questions:
  • Oxidative phosphorylation is also known as
    11·2 answers
  • Based on your knowledge of our solar<br> system, how do you think it originally<br> formed?
    14·1 answer
  • Which cell structure serves the state of function in both eukaryotic and prokaryotic cells?
    14·1 answer
  • Write a paragraph as if you are a molecule of ammonia that will be converted to uric acid and then to urea and excreted as urine
    12·2 answers
  • Does cigarette smoking have cognitive effects
    11·1 answer
  • The image below shows a weather service map. A weather service map. Lines are connecting points of equal air pressure. Lines are
    7·2 answers
  • Reset Hemopoiesis occurs in ____________ of certain bones. The process of hemopoiesis starts with hemopoietic stem cells called
    9·1 answer
  • How would more secondary consumers affect the biomass of the higher trophic levels?
    5·1 answer
  • Some evidence that vaccines are effective.
    11·1 answer
  • If there are 8 chromosomes in the parent cell, after Mitosis , how many chromosomes will be in the 2 daughter cells created?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!