1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aleksandrvk [35]
3 years ago
14

The bases of one of the strands of DNA in a region where DNA replication begins are shown here. What is the sequence of the prim

er that is synthesized complementary to the bases in bold? (Indicate the 5' and 3' ends of the sequence.) 5' AGGCCTCGAATTCGTATAGCTTTCAGAAA 3'
Biology
1 answer:
garik1379 [7]3 years ago
5 0

Answer:

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

Explanation:

The synthesized primer will have base pair complementary to the given strand and also the leading and lagging ends will be opposite to the given strand.

As per the base pair rule for DNA

Guanine binds to cytosine & vice versa

Adenine always binds to thymine & vice versa

Given Sequence -                5' AGGCCTCGAATTCGTATAGCTTTCAGAAA 3'

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

You might be interested in
Polydactyly is an inherited trait that results in extra fingers or toes. In the United States 0.1% of the population exhibits po
ANEK [815]

Answer:

c. The P allele is less frequent in the US than the p allele.

Explanation:

If people with the heterozygous genotype "Pp" present polydactyly, only people with the genotype "pp" will not present polydactyly. Since 99.9% of the population do not exhibit polydactyly, then it can be concluded that the "p" allele is much more frequent in the US than the "P" allele.

Therefore, the answer is:

c. The P allele is less frequent in the US than the p allele.

4 0
3 years ago
Consider the following prediction.
natka813 [3]

The correct answer to this question is:

“The prediction is useful because it explains what observations will be made if a hypothesis is true.”

6 0
3 years ago
Read 2 more answers
An igneous rock that contains mostly pyroxene and olivine has ?
Masteriza [31]
It sounds like you may be looking for Peridotite, which is a type of ultramafic igneous rock that contain olivine as their main mineral in combination with <span>pyroxenes and amphiboles. I hope this helps! </span>
5 0
3 years ago
Read 2 more answers
Explain why the amount of rainfall a region receives is a better determination of whether it is a desert than temperature.
Gnoma [55]
<span>As there are many kinds of deserts, some hot, some cold even arid deserts are the classic hot deserts, but there are also cold and coastal deserts where temperatures do not get so high. The element common to all of these types of deserts, however, is their lack of rainfall. In that sense the rainfall is a characteristic that determines if it's a desert.</span>
3 0
3 years ago
Read 2 more answers
Which of the following is true of conifers?
Korvikt [17]

Answer:

d

Explanation:

6 0
3 years ago
Other questions:
  • The ability to _ is an adaption to avoid predators ?
    13·1 answer
  • Hybrids between grizzly and polar bears have been moving farther north. What do you predict about the migration of their hybrid
    7·1 answer
  • Nerve endings in the skin are located in the
    5·1 answer
  • Blood velocity is measured in _________ and is generally _________ related to total cross-sectional area of blood vessels.
    6·1 answer
  • Which element is considered the most versatile element in living organisms and why?
    6·1 answer
  • Which of the following will open the cones of lodgepole pines to release their seeds?
    6·1 answer
  • In which organs would chemicals digesttionof the chicken takes place​
    14·1 answer
  • REUSE<br>How can I reuse things at school?​
    10·1 answer
  • Question 8 of 10
    12·2 answers
  • A fossil is found to have a 14c14c level of 73. 73. 0 ompared to living organisms. how old is the fossil?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!