1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aleksandrvk [35]
2 years ago
14

The bases of one of the strands of DNA in a region where DNA replication begins are shown here. What is the sequence of the prim

er that is synthesized complementary to the bases in bold? (Indicate the 5' and 3' ends of the sequence.) 5' AGGCCTCGAATTCGTATAGCTTTCAGAAA 3'
Biology
1 answer:
garik1379 [7]2 years ago
5 0

Answer:

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

Explanation:

The synthesized primer will have base pair complementary to the given strand and also the leading and lagging ends will be opposite to the given strand.

As per the base pair rule for DNA

Guanine binds to cytosine & vice versa

Adenine always binds to thymine & vice versa

Given Sequence -                5' AGGCCTCGAATTCGTATAGCTTTCAGAAA 3'

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

You might be interested in
Every cell in your body contains organelles
anygoal [31]
Yes that's right, its True, are structures that have specific functions
6 0
3 years ago
Read 2 more answers
A blastocyst is a A blastocyst is a
Alex_Xolod [135]
It is a hollow ball of cells formed after a fertilized cell undergoes cell division.
I'm a Biology major, hope I helped :)
3 0
3 years ago
Read 2 more answers
Plz help me get this right
astra-53 [7]
The answer is conduction
8 0
2 years ago
Read 2 more answers
Your skeletal stores calcium. How does the calcium get into your body
frosja888 [35]

The calcium get into your body through Vitamin D.

<u>Explanation:</u>

In order to make the bones healthy, calcium and phosphorus is very essential.  Calcium cannot be made by human body. The body only gets the calcium it needs, by means the food you eat, or from supplements. Vitamin D plays a major role in the absorption of calcium in human body. Calcium is a major mineral in a human body that helps in the proper working of body cells and nerves.

The quantity of the minerals like calcium, phosphorous,etc that are present in a segment of bone determines the density of bone. A percentage of 15 to 20 of calcium is absorbed from the diet that human intake. When the levels of vitamin D is low, there will be lower intake to calcium by gut. This causes the bones to become weaker.

3 0
2 years ago
Two objects that are at different temperatures are added to a container of water and then the container is closed. The temperatu
FrozenT [24]

Answer:

C

Explanation:

The water started out lower than 40°C.

8 0
3 years ago
Other questions:
  • Nitrogen fixation is a process that changes nitrogen within plants and soil into_____
    9·1 answer
  • How do nutrients get to the cells in a flatworms solid acoelomate body?
    7·1 answer
  • Which is a nucleic acid? ATP NH2 CH4 RNA
    9·2 answers
  • Select all that apply
    13·2 answers
  • According to the principal of dominance, if a recessive gene for tallness is paired with another recessive gene for tallness, th
    13·1 answer
  • Compare the productivity of terrestrial and aquatic ecosystems against the percent of Earth's surface area they occupy.
    15·1 answer
  • Can someone help me with this. I´ll give you the BRAINLEST!!
    10·2 answers
  • Why nitrogen needs to be cycled around<br>the environment?<br>​
    15·1 answer
  • What is the function of the organelle labeled A in the diagram?
    7·1 answer
  • Which statement best describes the population at point B?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!