1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aleksandrvk [35]
3 years ago
14

The bases of one of the strands of DNA in a region where DNA replication begins are shown here. What is the sequence of the prim

er that is synthesized complementary to the bases in bold? (Indicate the 5' and 3' ends of the sequence.) 5' AGGCCTCGAATTCGTATAGCTTTCAGAAA 3'
Biology
1 answer:
garik1379 [7]3 years ago
5 0

Answer:

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

Explanation:

The synthesized primer will have base pair complementary to the given strand and also the leading and lagging ends will be opposite to the given strand.

As per the base pair rule for DNA

Guanine binds to cytosine & vice versa

Adenine always binds to thymine & vice versa

Given Sequence -                5' AGGCCTCGAATTCGTATAGCTTTCAGAAA 3'

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

You might be interested in
Monomers are the building blocks of which of the following? SELECT ALL THAT APPLY
kirill [66]

Monomers are molecules whose linkage between them form polymers.

<h3>What are monomers?</h3>

Monomers are molecules that have a low molecular mass.

<h3>Characteristics of monomers</h3>

  • When many monomers come together through chemical bonds they form a polymer, which is a macromolecule.

  • Natural monomers allow the formation of biomolecules found in living beings.

  • Carbohydrates, for example, are macromolecules that are created from the bond established by monosaccharides (monomers).

Therefore, we can conclude that polymers, in short, are chains of monomers -generally joined by covalent bonds-.

Learn more about monomers here: brainly.com/question/24573189

3 0
2 years ago
Is wet or dry food better for my hedgehog?
LUCKY_DIMON [66]
I think you should feed your hedgehog dry food
8 0
3 years ago
Which of the following creates variation within a population?
Lemur [1.5K]
A hope this helps :)
7 0
2 years ago
Read 2 more answers
When you see _____ clouds it means the weather might be changing soon.
Alenkinab [10]

Answer:

the answer is when you see cirrus clouds...

3 0
3 years ago
What is the significance of the Agricultural Revolution?
Nutka1998 [239]

Answer:

Hope this is helpful to you!

The Agricultural Revolution of the 18th century paved the way for the Industrial Revolution in Britain. New farming techniques and improved livestock breeding led to amplified food production. This allowed a spike in population and increased health. The new farming techniques also led to an enclosure movement.

5 0
2 years ago
Other questions:
  • Which of the following is involved in "double fertilization"?
    14·1 answer
  • Which kind of diagram shows the amount of organic matter in the trophic levels of an ecosystem?
    6·1 answer
  • Why must reverse transcriptase be used to create a eukaryotic expression library?
    7·1 answer
  • A rock formed from the remains of living organisms. the rock is pale in color and soft. the rock is probably a
    10·1 answer
  • Points
    15·2 answers
  • Please help, totally confused :(((
    6·1 answer
  • Which structures are contralateral? left leg, right leg right leg, right arm liver, heart superior vena cava, inferior vena cava
    6·1 answer
  • 1. What does "semiconservative replication" mean?
    8·1 answer
  • 8)
    12·2 answers
  • Which process takes CO2 out of the atmosphere
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!