1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aleksandrvk [35]
3 years ago
14

The bases of one of the strands of DNA in a region where DNA replication begins are shown here. What is the sequence of the prim

er that is synthesized complementary to the bases in bold? (Indicate the 5' and 3' ends of the sequence.) 5' AGGCCTCGAATTCGTATAGCTTTCAGAAA 3'
Biology
1 answer:
garik1379 [7]3 years ago
5 0

Answer:

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

Explanation:

The synthesized primer will have base pair complementary to the given strand and also the leading and lagging ends will be opposite to the given strand.

As per the base pair rule for DNA

Guanine binds to cytosine & vice versa

Adenine always binds to thymine & vice versa

Given Sequence -                5' AGGCCTCGAATTCGTATAGCTTTCAGAAA 3'

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

You might be interested in
Electrical wires are generally protected by a tube of plastic. a similar insulating function is performed in the nervous system
Allisa [31]

The myelin sheath is the protective layer, which is present in the outer layer of the neural cells. This myelin sheath prevents the loss of electrical impulses, which are being conducted in the neurons. This also act as an insulator between neuron and its external environment.

This layer is mainly made up of the protein and fatty substance. The degeneration of the myelin sheath result in many neurological disorders.


Hence, the correct answer is myelin sheath.

7 0
3 years ago
What are three proteins that are made at the cell's ribosomes?
nevsk [136]
The answer is Actin, tubulin, Titin 
PLEASE MARK AS BRAINLIEST
6 0
3 years ago
Read 2 more answers
What happens next after a glacier recedes and exposes bare rock?
IRISSAK [1]
Lichen will colonize the bare rock.
4 0
4 years ago
Read 2 more answers
Why are we alive? Just to die?
babymother [125]
Pretty much but enjoy life while you have it because you never know when your time to leave may come
7 0
3 years ago
Read 2 more answers
During photosynthesis, energy poor reactants are provided with an energy input and form an energy rich in product. This is a(n)
TEA [102]
A. This is an endergonic reaction because the free energy of the reactant is lower than the free energy of the products.
7 0
3 years ago
Other questions:
  • If Pavlov repeatedly presented the conditioned stimulus, the metronome, without the unconditioned stimulus, the food, the dogs w
    12·1 answer
  • Much like carbon, the recycling of nitrogen through Earth's spheres relies heavily on what type of organism?
    7·1 answer
  • How would you go about isolating your pure culture?
    7·1 answer
  • How how does hypertension affect the kidney
    5·1 answer
  • If a pair of organisms are capable of producing fertile offspring in nature, they must belong to the same A) class B) kingdom C)
    7·2 answers
  • Riboswitches are folded RNAs that act as switches to turn protein synthesis on or off in response to _________.
    11·1 answer
  • When conducting a biology investigation, why is it important to note the safety rules and symbols?
    11·2 answers
  • The different forms of a gene are called<br> (1 Point)<br> traits<br> hybrids<br> alleles
    6·1 answer
  • A human’s knee joint is best described as
    9·2 answers
  • Which of the following layers of the atmosphere where the molecules are gravitationally bound to that body?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!