1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aleksandrvk [35]
3 years ago
14

The bases of one of the strands of DNA in a region where DNA replication begins are shown here. What is the sequence of the prim

er that is synthesized complementary to the bases in bold? (Indicate the 5' and 3' ends of the sequence.) 5' AGGCCTCGAATTCGTATAGCTTTCAGAAA 3'
Biology
1 answer:
garik1379 [7]3 years ago
5 0

Answer:

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

Explanation:

The synthesized primer will have base pair complementary to the given strand and also the leading and lagging ends will be opposite to the given strand.

As per the base pair rule for DNA

Guanine binds to cytosine & vice versa

Adenine always binds to thymine & vice versa

Given Sequence -                5' AGGCCTCGAATTCGTATAGCTTTCAGAAA 3'

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

You might be interested in
5. Suppose a non-native species of beetle is
schepotkina [342]
U can tell by there eyes
8 0
3 years ago
why is the diversity of living things in salt water greater than in fresh water? give as many reasons you can think of. will giv
Degger [83]

Answer:

For one thing, there's lots more of it. There are many more environmental niches to be occupied in salt-water bodies, and importantly, they're all connected, making it easier for species to migrate and adapt to new habitats. Conversely, fresh-water habitats are often more isolated, confining species to a single habitat and decreasing the likelihood that they'll be able to migrate and adapt.

Explanation:

6 0
3 years ago
Does social distancing increase or decrease your carbon footprint?
Andrej [43]

Answer:

Decrease

Explanation:

The carbon footprint is <u>the amount of carbon (in terms of greenhouse gases) being emitted by human activities</u>. In a situation where <u>social distancing is encouraged, human activity would reduce significantly</u>. Very few people will be outside and the causative agents of pollution (anthropogenic) will be significantly reduced. Further, nature would be able to minimize the impacts of pollution when human activities are less than the threshold capacity.

Let's take an example of coronavirus spread globally this year. The social distancing of 2 meters has significantly reduced the number of people going outside. Ultimately, there are fewer automobiles on the roads and a few industries are running. The result is that the air quality index has been significantly improved. For example, in India, people from 300 km away, can see the Himalayan mountain range very clearly (see image attached). This has not happened in decades after modern industrialization.

4 0
3 years ago
Which were the elements to form in the earliest stage of the universe?
Doss [256]

Explanation:

AswerB

hydrogen, helium and lithium

It took 380,000 years for the electrons to be trapped in orbits nuclei forming the first atoms. (which is option B)

6 0
3 years ago
12. In our somatic (body) cells, we have ___________ chromosomes, but in our sex cells (sperm &amp; eggs), we have half the numb
Sliva [168]

Answer:

12. In our somatic (body) cells, we have 2N chromosomes, but in our sex cells (sperm & eggs), we have half the number of chromosomes, which is N chromosomes

Explanation:

5 0
3 years ago
Other questions:
  • Matching chromosomes
    13·1 answer
  • A client reports sensing an unusual smell just prior to experiencing a tonic–clonic seizure. what term is used to describe this
    6·1 answer
  • If limestone is exposed to the correct amount of heat and pressure what can it become
    7·1 answer
  • You learned about wave energy, tidal energy, and current energy. Think about the coastline closest to where you live. Which type
    6·1 answer
  • What do centromeres attach to during metaphase
    6·1 answer
  • Society expects scientists to follow ethical practices and meet many ethical standards. Which is an example of one of these ethi
    14·2 answers
  • What happens during the S subphase of interphase?
    8·1 answer
  • I will give brainliest please help
    6·1 answer
  • which of the following changes would most likely lead to a mammal population exceeding its carrying capacity
    7·1 answer
  • The original sequence of DNA was ACT GGA GGG CAC but when the DNA was replicated an error
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!