1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aleksandrvk [35]
3 years ago
14

The bases of one of the strands of DNA in a region where DNA replication begins are shown here. What is the sequence of the prim

er that is synthesized complementary to the bases in bold? (Indicate the 5' and 3' ends of the sequence.) 5' AGGCCTCGAATTCGTATAGCTTTCAGAAA 3'
Biology
1 answer:
garik1379 [7]3 years ago
5 0

Answer:

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

Explanation:

The synthesized primer will have base pair complementary to the given strand and also the leading and lagging ends will be opposite to the given strand.

As per the base pair rule for DNA

Guanine binds to cytosine & vice versa

Adenine always binds to thymine & vice versa

Given Sequence -                5' AGGCCTCGAATTCGTATAGCTTTCAGAAA 3'

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

You might be interested in
Please help me with this question about chromosomes
kykrilka [37]

Answer:

The third one!

6 0
3 years ago
Tree leaves contain nutrients that are important for trees to grow. When the leaves fall off of the trees, they take those nutri
liraira [26]

Answer:i think its C or D

Explanation:

It cant be chemoautotrophs or photoatropus

4 0
2 years ago
Identify the type of carbohydrate.
Ann [662]
Suger is a type of carbohydrate
6 0
3 years ago
Which of Mendel's laws or principles states that gametes carry one allele for each trait?
Burka [1]
Law of segregation states that <span>gametes carry one allele for each trait
As it states that
</span>that during the production of gametes the two copies of each hereditary factor segregate<span> during the production of gametes</span>  so that offspring acquire one of the two allele  from each parent
so option C is correct
hope it helps
5 0
3 years ago
Read 2 more answers
How do single-celled decomposers get energy?
salantis [7]

Answer:

D. They break down dead organisms.

Explanation:

3 0
3 years ago
Other questions:
  • What do micro-algae and macro-algae have in common?
    13·1 answer
  • Binary fission is the most common form of reproduction in _____.
    13·2 answers
  • In the sweet pea crossing experiment by Bateson and Punnet, the F2 generation had many more offspring with the phenotypes of pur
    14·1 answer
  • What is not evidence for plate tectonics? A. the presence of glaciers B. the distribution of earthquakes and volcanoes C. the co
    9·2 answers
  • Where does most of the phosphorus cycle take place?
    12·1 answer
  • Root cause analyses can be useful in health care because: (a) they help to assign blame. (b) they help to identify system failur
    8·1 answer
  • Question 5
    8·1 answer
  • the average hair skin and nails have a pH level of five generally falling between 4.5 and 6 true or false
    14·1 answer
  • How does the density of the block change when you adjust the volume?
    5·1 answer
  • The genetic material inherited in an organelle, such as a mitochondrion or a chloroplast, exhibits _____ inheritance.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!