1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
emmasim [6.3K]
3 years ago
10

What killed a Hoover dam worker every 2 days

Biology
1 answer:
Dvinal [7]3 years ago
8 0
<span>harsh conditions. 
</span><span>high scalers' work </span>
You might be interested in
The atomic mass is the _____.
Blababa [14]

Answer: number of protons plus the number of neutrons

8 0
3 years ago
The bones in the front leg of an iguana and in the wing of a bat are evolutionary derived from their common ancestor. Based on t
nikitadnepr [17]
They were most likely related in the past
6 0
2 years ago
The graph depicts the velocity and times of Elan and Anna during a race
Anarel [89]
The anwser is c hope this helps

3 0
3 years ago
Read 2 more answers
In the excretory system , a waste substance called ______ is filtered out of the blood.
Kitty [74]

Answer:

urea

ignore this line

8 0
1 year ago
A radioactively labeled protein is made by cells and followed through various organelles in the secretory pathway. After six hou
kupik [55]

Answer:

The protein is targeted to Golgi apparatus.

Explanation:

Protein targeting or sorting is a process by which synthesized proteins are transported to their appropriate localizations in the cell or outside it. Proteins can be targeted to the inner space of an organelle (such as Golgi apparatus or endoplasmic reticulum) or its membrane, plasma membrane, or to exterior of the cell via secretion.  

Usually, protein contains signal sequence on the N terminus that is involved in destination targeting.

5 0
3 years ago
Other questions:
  • Please help with this biology question<br><br> image attached
    7·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • Why was the blood bright red, rather than the color of "coffee grounds"?
    6·1 answer
  • Foresters recently noticed an apparent drop in the squirrel population in a near-by oak-hickory forest. The squirrels eat acorns
    14·2 answers
  • Which of the following is not a state of matter?
    11·1 answer
  • What process is used to link amino acids together? Name the bonds found between amino acids in a polypeptide chain? Explain the
    10·1 answer
  • If you were assigned the task of constructing a cladogram representing the evolutionary relationship between amphibians, turtles
    15·2 answers
  • During which of the following cells become specialized to perform certain functions. differration, reproduction, mitosis.
    13·2 answers
  • The cell is undergoing meiosis Il. Which stage of Meiosis Il is the cell in?
    10·1 answer
  • HELP PLEASEEEEEEE guys
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!