1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Varvara68 [4.7K]
3 years ago
14

Which process makes it possible for the body to grow and repair? Meiosis Sexual reproduction Replication Mitosis

Biology
1 answer:
ArbitrLikvidat [17]3 years ago
3 0
Meiosis sexual reproduction only occurs in the gametes, which do not contribute to the body's growth and repair, only reproduction.
Replication mitosis, however, produces diploid cells identical to the parent/mother cell, which aids in the body's growth and repair. 
You might be interested in
Question 1 (1 point) Question 1 Unsaved
IgorC [24]

question 1 is B

QUESTION 2 IS C

question 3 is a

question 4 is b

question  is d

question 8 is b

6 0
3 years ago
No spam if u spam i will report u
sashaice [31]

Answer:

no irrelevant information,if any you will be reportef

5 0
3 years ago
Read 2 more answers
What are the the Plate made of (the layer of the Earth?) and what do they do?
DaniilM [7]

Answer: The earth is made up of three different layers: the crust, the mantle and the core. This is the outside layer of the earth and is made of solid rock, mostly basalt and granite. There are two types of crust; oceanic and continental. Oceanic crust is denser and thinner and mainly com​posed of basalt.

Explanation:

6 0
3 years ago
Which of the following is an example of parasite?<br> Molds<br> Mosquitoes<br> Yeasts<br> Zika
Svetlanka [38]

Answer:

zika is a parasite

Explanation:

this is a common parasite but if you want my personal opinion, the parasite is none of these, its my younger brother.

4 0
2 years ago
Read 2 more answers
Bacteria containing a plasmid into which the eukaryotic gene has integrated would grow in
Furkat [3]
For the answer to the question above, I believe that a
Bacteria containing a plasmid into which the eukaryotic gene has integrated would grow in<span> "the ampicillin broth and the nutrient broth."</span> is the answer to your question. I hope this helps.
5 0
3 years ago
Other questions:
  • which four elements are found most abundantly in the micro molecules? Carbon, Fluorine, Hydrogen, Iodine, Nitrogen, oxygen, or P
    13·1 answer
  • Gene mutations can be passed on to future generations and drive natural selection. Choose the best description of how Gene mutat
    11·1 answer
  • What is an example of temporary change
    12·2 answers
  • What information can you learn from electrophoresis
    7·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • Why does the land around a once active coal mine remain barren?
    11·1 answer
  • Determine whether each statement correctly describes the myocardial action potential and the pacemaker potential. 1. Because the
    15·1 answer
  • Hi Please help me?!!
    5·1 answer
  • Ssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssss
    15·2 answers
  • One species of tree snail is found on a single island in the pacific. A storm knocks down one tree that contains 50 snails and i
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!