1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anvisha [2.4K]
4 years ago
13

In normal blood counts, the most abundant cells in the blood are

Biology
1 answer:
eimsori [14]4 years ago
4 0
Neutrophils which are Leukocytes
You might be interested in
Following cytokinesis in an animal cell, how many centrioles does each new daughter cell possess?
nika2105 [10]

Answer:

two (a pair)

Explanation:

Centrioles are the pair of hollow cylinders that are located near the nucleus in the cytoplasm in a non-dividing cell. Two centrioles together make a centrosome. Centriole duplication occurs before cell division as the duplicated centrioles take part in the formation of the spindle apparatus. However, cytokinesis distributes one pair of centrioles to each daughter cell. Therefore, after cytokinesis, two centrioles are present in each daughter cell.

4 0
4 years ago
What habitat is home to 50% of animal species, 70% of plant species, and is currently being destroyed by humans?
harina [27]

Answer:

Unique Biodiversity. Eighty percent of the world's known terrestrial plant and animal species can be found in forests, and tropical rainforests are home to more species than any other terrestrial habitat. A square kilometer of forest may be home to more than 1,000 species.

Explanation:

4 0
3 years ago
What is the solar process that results in the production of energy?
pentagon [3]

Solar energy is created by nuclear fusion that takes place in the sun. Fusion occurs when protons of hydrogen atoms violently collide in the sun's core and fuse to create a helium atom. This process, known as a PP (proton-proton) chain reaction, emits an enormous amount of energy.

5 0
3 years ago
Why is acetylcholine broken down?
Aneli [31]

Acetylcholine broken down is the process by which this neurotransmitter activates a suitable ligand-receptor to trigger a cell signaling pathway.

<h3>What is Acetylcholine?</h3>

Acetylcholine is a chemical messenger (i.e., a neurotransmitter) that is used to transmit signals inside the body.

Acetylcholine broken down is due to its hydrolysis, which ends cell signaling between brain synapses.

In conclusion, Acetylcholine broken down is the process by which this neurotransmitter activates a suitable ligand-receptor to trigger a cell signaling pathway.

Learn more about Acetylcholine signaling here:

brainly.com/question/13993931

#SPJ12

8 0
2 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
Other questions:
  • Which of the following statements about gluconeogenesis in animal cells is true?
    13·1 answer
  • Insulin is synthesized in the form of a precursor proteinthat requires cleavage of two different peptide segmentsbefore the matu
    12·1 answer
  • All living organisms are made from different combinations of only ___________ amino acids
    14·1 answer
  • How do bugs poop I’m so confused
    15·2 answers
  • What types of traits can show genetic variation within a species?​
    9·1 answer
  • The mass of an object doubles. What happens to the gravitational force between it and another object whose mass stays the same,
    15·1 answer
  • Which of the following reasons explains a possible advantage of using adult stem cells in therapeutic cloning rather than embryo
    7·2 answers
  • Discuss how the concept of "survival of the fittest" was developed and what it means.
    15·1 answer
  • In a plant, what is formed by a group of xylem vessels?
    10·1 answer
  • SAVAGE, #followme OH AND TO ANYONE WHO REPORTS THIS IM ASKING A QUESTION. hows ur life? #biology
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!