Lactic acid is a byproduct of short-term cellular respiration do to exercise, but if you mean lactose, then it's just the enzymes, that your stomach produces
Its the Eccentricity of the earth. (shape of Earth's Orbit around the sun, whether it is more circular or ovular.)
Answer:true
Explanation:
Yoga's origins can be traced to northern India over 5,000 years ago. The word yoga was first mentioned in ancient sacred texts called the Rig Veda. ... Yoga was refined and developed by Rishis (sages) who documented their practices and beliefs in the Upanishads, a huge work containing over 200 scriptures.
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
Answer:
The change of the wick to carbon from the burning is a chemical change
