1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Over [174]
3 years ago
8

What is the purpose of studying and dissecting an earthworm?

Biology
1 answer:
White raven [17]3 years ago
4 0
When studying an earth worm, we could see all the amazing things God gave this creature and how it survives. If we dissect an earthworm, we will probably find out that it has multiple flexible parts that allow it to move around under ground. We could test this by filling a see through tank of some sort with dirt and water. We find an earthworm and let it stay in. We could examine that the worm stays on the surface for a little and than proceeds to its hole making. After a while, we could examine the tank and find that the dirt has many holes around it. Eventually let the worm go! This project could teach you something about worms. Worms are also helpful creatures. They provide the plants all the nutrients they need. 

Hopefully I helped your question... but please make sure it's school related because people lose there time on, to answer these for you! :) I was happy to help! :) ;)
You might be interested in
Children are spending less time outdoors in nature because of which reason(s)
Mrrafil [7]
The two biggest reasons for children spending less time outside are the development of technology and the safety issues. The development of technology brought in our homes countless forms of having fun which is very important to children. The mobile phones, PC's, laptop's, tablets, Sony Play Station, as well as lots of technologically improved toys, made the children stay at home since they have the fun indoors, and not be interested in going outside and in nature. Also the safety issues in lots of parts in the world made the parents to restrict the children to the indoors environment.
4 0
3 years ago
Zebra mussels are tiny clam-like organisms that strain plankton out of the lake water. They attach to piers, boat hulls, pipes,
-Dominant- [34]
<h2>Availability of Plankton</h2>

Explanation:

  • The term plankton comes from the Greek derivative planktos, meaning wandering. Organisms in this group spend either part or all of their life in a drifting state, with no ability to swim against a current. Most have little or no ability to swim at all. Though some are larger, most planktonic creatures are microscopic and make up the bottom of the food chain in aquatic environments
  • Plankton can be divided into two categories: phytoplankton are those organisms that are plant-like, and zooplankton are organisms that are animal-like. Interestingly enough, many planktonic species are neither plant nor animal but are creatures that belong to the kingdom Protista
  • Zebra muscles are found in water bodies which attached to pipes and other surfaces of water supply to impliment the availability of plankton

5 0
3 years ago
How does the environment select organisms
Maru [420]
The process in which the environment<span> selects </span>organisms<span> that will survive is called natural selection. It starts with overproduction; when an </span>organism<span> produces more offpsrings than can survive. The second is variation. Because there are so many offsprings, there will be variations.</span>
6 0
3 years ago
Read 2 more answers
What is sea turtle migration
IgorLugansk [536]

Answer:

Sea turtle migration is the long distance movements of sea turtles. It may refer to adults or the offshore migration of hatchlings.

6 0
3 years ago
What is the general term used to describe a group of diseases in which intestinal uptake of nutrients is impaired?
loris [4]

The term used for the condition, in which the uptake of nutrients from the small intestine is impaired is malabsorption.

The malabsorption is a condition, in which the small intestine walls become unable to uptake the nutrients in the blood. This condition can be caused by many different reasons, which affect the wall of the intestine. These conditions include infections, trauma, celiac disease, and surgery. Some diseases such as Crohn's disease, pancreatitis (chronic), or cystic fibrosis is also responsible for the malabsorption.

6 0
3 years ago
Other questions:
  • What are some of the limitations that natural selection has on the ecosystem?
    8·1 answer
  • A nursing instructor is teaching students about skin structure. The instructor evaluates student knowledge of the Langerhans cel
    13·1 answer
  • The characteristic of adaptive immunity by which the adaptive immune response acts against one molecular shape and no others is
    7·1 answer
  • PLEASE HELP ME ILL MARK BRAINLIEST CORRECT ANSWer thank you
    8·1 answer
  • What is another term for the responding variable?
    6·2 answers
  • But, all researchers have arrived at the same conclusion. What does this say about the conclusion?
    13·1 answer
  • What are the four major blood groups?
    8·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • CH3<br> CH2-CH2-CH-CH2-CH?<br> 1<br> 1<br> OH<br> Name the compound
    12·2 answers
  • Which one of the following does NOT describe a use of a scientific model?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!